EMAIL THIS PAGE TO A FRIEND

CELA3B

chymotrypsin-like elastase family, member 3B

Synonyms: CBPP E1 EL-1 ELA3B
UniProtKB ID: P08861, B2RE44, P11423, Q5VU28, Q5VU29, Q5VU30
Gene ID:
Human(23436) Summary: Elastases form a subfamily of serine proteases that hydrolyze many proteins in addition to elastin. Humans have six elastase genes which encode the structurally similar proteins elastase 1, 2, 2A, 2B, 3A, and 3B. Unlike other elastases, elastase 3B has little elastolytic activity. Like most of the human elastases, elastase 3B is secreted from the pancreas as a zymogen and, like other serine proteases such as trypsin, chymotrypsin and kallikrein, it has a digestive function in the intestine. Elastase 3B preferentially cleaves proteins after alanine residues. Elastase 3B may also function in the intestinal transport and metabolism of cholesterol. Both elastase 3A and elastase 3B have been referred to as protease E and as elastase 1, and excretion of this protein in fecal material is frequently used as a measure of pancreatic function in clinical assays. [provided by RefSeq, May 2009]
Mouse(67868) chymotrypsin-like elastase family, member 3B
Rat(298567) chymotrypsin-like elastase family, member 3B
dog(478196) chymotrypsin-like elastase family, member 3B
domestic cat(101094275) chymotrypsin-like elastase family, member 3B
cow(281752) chymotrypsin-like elastase family, member 3B
naked mole-rat(101701010) chymotrypsin-like elastase family, member 3B
domestic guinea pig(100717936) chymotrypsin-like elastase family, member 3B
52 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026419 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026419 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026419 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007352 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007352 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007352 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007352 Rosetta Predictions human pricing
NM_001106692 Rosetta Predictions rat pricing
NM_026419 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007352 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00116164 predicted 365
2 SASI_Hs01_00116166 predicted 370
3 SASI_Hs01_00116167 predicted 693
4 SASI_Hs02_00343449 predicted 373
5 SASI_Hs01_00116160 predicted 578
6 SASI_Hs01_00116161 predicted 495
7 SASI_Hs01_00116162 predicted 242
8 SASI_Hs01_00116163 predicted 734
9 SASI_Hs01_00116165 predicted 559
10 SASI_Hs01_00116168 predicted 237
11 SASI_Hs01_00116169 predicted 573
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106692 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00221448 predicted 274
2 SASI_Rn02_00221449 predicted 483
3 SASI_Rn02_00221450 predicted 638
4 SASI_Rn02_00221451 predicted 640
5 SASI_Rn02_00221452 predicted 482
6 SASI_Rn02_00221453 predicted 486
7 SASI_Rn02_00221454 predicted 637
8 SASI_Rn02_00221455 predicted 589
9 SASI_Rn02_00221456 predicted 531
10 SASI_Rn02_00221457 predicted 331
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026419 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00044340 predicted 360
2 SASI_Mm02_00330227 predicted 599
3 SASI_Mm01_00044341 predicted 645
4 SASI_Mm01_00044344 predicted 253
5 SASI_Mm01_00044346 predicted 318
6 SASI_Mm02_00330228 predicted 230
7 SASI_Mm01_00044347 predicted 356
8 SASI_Mm02_00330229 predicted 346
9 SASI_Mm02_00330230 predicted 513
10 SASI_Mm02_00330231 predicted 628
11 SASI_Mm01_00044339 predicted 460
12 SASI_Mm01_00044342 predicted 275
13 SASI_Mm01_00044343 predicted 513
14 SASI_Mm01_00044345 predicted 473
15 SASI_Mm01_00044348 predicted 639
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026419
CELA3B MISSION shRNA Bacterial Glycerol Stock
chymotrypsin-like elastase family, member 3B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026419.1-253s1c1
Sequence:CCGGCGCACCTACCAGGTTGTACTTCTCGAGAAGTACAACCTGGTAGGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026419.1-639s1c1
Sequence:CCGGCGATATCCAGTCTGGCTGCAACTCGAGTTGCAGCCAGACTGGATATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026419.1-518s1c1
Sequence:CCGGCCAATGGACCTCTGCCAGACACTCGAGTGTCTGGCAGAGGTCCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026419.1-100s1c1
Sequence:CCGGCGAGTTGTCAATGGCGAGGAACTCGAGTTCCTCGCCATTGACAACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026419.1-349s1c1
Sequence:CCGGCCCAAGTGGAACTCTATGTGTCTCGAGACACATAGAGTTCCACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026419
CELA3B MISSION shRNA shRNA Plasmid DNA
chymotrypsin-like elastase family, member 3B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026419.1-253s1c1
Sequence:CCGGCGCACCTACCAGGTTGTACTTCTCGAGAAGTACAACCTGGTAGGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026419.1-639s1c1
Sequence:CCGGCGATATCCAGTCTGGCTGCAACTCGAGTTGCAGCCAGACTGGATATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026419.1-518s1c1
Sequence:CCGGCCAATGGACCTCTGCCAGACACTCGAGTGTCTGGCAGAGGTCCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026419.1-100s1c1
Sequence:CCGGCGAGTTGTCAATGGCGAGGAACTCGAGTTCCTCGCCATTGACAACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026419.1-349s1c1
Sequence:CCGGCCCAAGTGGAACTCTATGTGTCTCGAGACACATAGAGTTCCACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026419
CELA3B MISSION shRNA Lentiviral Transduction Particles
chymotrypsin-like elastase family, member 3B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026419.1-253s1c1
Sequence:CCGGCGCACCTACCAGGTTGTACTTCTCGAGAAGTACAACCTGGTAGGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026419.1-639s1c1
Sequence:CCGGCGATATCCAGTCTGGCTGCAACTCGAGTTGCAGCCAGACTGGATATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026419.1-518s1c1
Sequence:CCGGCCAATGGACCTCTGCCAGACACTCGAGTGTCTGGCAGAGGTCCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026419.1-100s1c1
Sequence:CCGGCGAGTTGTCAATGGCGAGGAACTCGAGTTCCTCGCCATTGACAACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026419.1-349s1c1
Sequence:CCGGCCCAAGTGGAACTCTATGTGTCTCGAGACACATAGAGTTCCACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007352
CELA3B MISSION shRNA Bacterial Glycerol Stock
chymotrypsin-like elastase family, member 3B
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007352.1-556s1c1
Sequence:CCGGCTGCCGGTGGTGGACTATGAACTCGAGTTCATAGTCCACCACCGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007352.1-573s1c1
Sequence:CCGGTGAACACTGCTCCAGGTGGAACTCGAGTTCCACCTGGAGCAGTGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007352.1-724s1c1
Sequence:CCGGACCAGCTTTGTTTCTGCCTTTCTCGAGAAAGGCAGAAACAAAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007352.1-251s1c1
Sequence:CCGGCCCGGACCTACCAGGTGGTGTCTCGAGACACCACCTGGTAGGTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007352.1-276s1c1
Sequence:CCGGCGAGTACGACCGTGCTGTGAACTCGAGTTCACAGCACGGTCGTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000446642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007352.2-573s21c1
Sequence:CCGGACGAGACACCCTGCTACATCACTCGAGTGATGTAGCAGGGTGTCTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007352.2-244s21c1
Sequence:CCGGGGTTTCCCTGCAGTATGAGAACTCGAGTTCTCATACTGCAGGGAAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007352
CELA3B MISSION shRNA shRNA Plasmid DNA
chymotrypsin-like elastase family, member 3B
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007352.1-556s1c1
Sequence:CCGGCTGCCGGTGGTGGACTATGAACTCGAGTTCATAGTCCACCACCGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007352.1-573s1c1
Sequence:CCGGTGAACACTGCTCCAGGTGGAACTCGAGTTCCACCTGGAGCAGTGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007352.1-724s1c1
Sequence:CCGGACCAGCTTTGTTTCTGCCTTTCTCGAGAAAGGCAGAAACAAAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007352.1-251s1c1
Sequence:CCGGCCCGGACCTACCAGGTGGTGTCTCGAGACACCACCTGGTAGGTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007352.1-276s1c1
Sequence:CCGGCGAGTACGACCGTGCTGTGAACTCGAGTTCACAGCACGGTCGTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000446642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007352.2-573s21c1
Sequence:CCGGACGAGACACCCTGCTACATCACTCGAGTGATGTAGCAGGGTGTCTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007352.2-244s21c1
Sequence:CCGGGGTTTCCCTGCAGTATGAGAACTCGAGTTCTCATACTGCAGGGAAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007352
CELA3B MISSION shRNA Lentiviral Transduction Particles
chymotrypsin-like elastase family, member 3B
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007352.1-556s1c1
Sequence:CCGGCTGCCGGTGGTGGACTATGAACTCGAGTTCATAGTCCACCACCGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007352.1-573s1c1
Sequence:CCGGTGAACACTGCTCCAGGTGGAACTCGAGTTCCACCTGGAGCAGTGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007352.1-724s1c1
Sequence:CCGGACCAGCTTTGTTTCTGCCTTTCTCGAGAAAGGCAGAAACAAAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007352.1-251s1c1
Sequence:CCGGCCCGGACCTACCAGGTGGTGTCTCGAGACACCACCTGGTAGGTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007352.1-276s1c1
Sequence:CCGGCGAGTACGACCGTGCTGTGAACTCGAGTTCACAGCACGGTCGTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000446642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007352.2-573s21c1
Sequence:CCGGACGAGACACCCTGCTACATCACTCGAGTGATGTAGCAGGGTGTCTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007352.2-244s21c1
Sequence:CCGGGGTTTCCCTGCAGTATGAGAACTCGAGTTCTCATACTGCAGGGAAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks