EMAIL THIS PAGE TO A FRIEND

CELF1

CUGBP, Elav-like family member 1

185 Gene Product Result for
Synonyms: BRUNOL2 CUG-BP CUGBP CUGBP1 EDEN-BP NAB50 NAPOR hNab50
Gene ID:
Human(10658) Summary: Members of the CELF/BRUNOL protein family contain two N-terminal RNA recognition motif (RRM) domains, one C-terminal RRM domain, and a divergent segment of 160-230 aa between the second and third RRM domains. Members of this protein family regulate pre-mRNA alternative splicing and may also be involved in mRNA editing, and translation. This gene may play a role in myotonic dystrophy type 1 (DM1) via interactions with the dystrophia myotonica-protein kinase (DMPK) gene. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(13046) CUGBP, Elav-like family member 1
Rat(362160) CUGBP, Elav-like family member 1
Zebrafish(58137) cugbp, Elav-like family member 1
cow(540475) CUGBP, Elav-like family member 1
Horse(100051608) CUGBP, Elav-like family member 1
domestic cat(101096102) CUGBP, Elav-like family member 1
dog(475979) CUGBP, Elav-like family member 1
chicken(373923) CUGBP, Elav-like family member 1
domestic guinea pig(100730258) CUGBP, Elav-like family member 1
naked mole-rat(101699832) CUGBP, Elav-like family member 1
sheep(101118301) CUGBP, Elav-like family member 1
Domestic Rabbit(100354668) CUGBP, Elav-like family member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198683 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198683 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198683 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006560 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006560 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006560 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001025596 Rosetta Predictions human pricing
NM_006560 Rosetta Predictions human pricing
NM_198700 Rosetta Predictions human pricing
NM_001025421 Rosetta Predictions rat pricing
NM_017368 Rosetta Predictions mouse pricing
NM_198683 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025596 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00155379 predicted 442
2 SASI_Hs01_00155380 predicted 1132
3 SASI_Hs01_00155381 predicted 1257
4 SASI_Hs01_00155382 predicted 204
5 SASI_Hs01_00155383 predicted 452
6 SASI_Hs01_00155384 predicted 1411
7 SASI_Hs01_00155385 predicted 1414
8 SASI_Hs01_00155386 predicted 285
9 SASI_Hs01_00155387 predicted 386
10 SASI_Hs01_00155388 predicted 1312
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006560 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00150532 predicted 591
2 SASI_Hs01_00150533 predicted 1260
3 SASI_Hs01_00150534 predicted 1386
4 SASI_Hs01_00150535 predicted 354
5 SASI_Hs01_00150536 predicted 591
6 SASI_Hs01_00150537 predicted 1544
7 SASI_Hs01_00150538 predicted 1547
8 SASI_Hs01_00150539 predicted 430
9 SASI_Hs01_00150540 predicted 529
10 SASI_Hs01_00150541 predicted 1443
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198700 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00211422 predicted 639
2 SASI_Hs01_00211423 predicted 1307
3 SASI_Hs01_00211424 predicted 1443
4 SASI_Hs01_00211425 predicted 403
5 SASI_Hs01_00211426 predicted 636
6 SASI_Hs01_00211427 predicted 1602
7 SASI_Hs01_00211428 predicted 1601
8 SASI_Hs01_00211429 predicted 470
9 SASI_Hs01_00211430 predicted 573
10 SASI_Hs01_00211431 predicted 1497
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025421 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00079741 predicted 1260
2 SASI_Rn01_00079742 predicted 1251
3 SASI_Rn01_00079743 predicted 221
4 SASI_Rn01_00079744 predicted 1160
5 SASI_Rn01_00079745 predicted 1433
6 SASI_Rn01_00079746 predicted 265
7 SASI_Rn01_00079747 predicted 409
8 SASI_Rn01_00079748 predicted 1030
9 SASI_Rn01_00079749 predicted 338
10 SASI_Rn02_00203168 predicted 288
11 SASI_Rn01_00079750 predicted 797
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017368 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00080179 predicted 1585
2 SASI_Mm01_00080181 predicted 549
3 SASI_Mm01_00080182 predicted 1470
4 SASI_Mm02_00323846 predicted 1758
5 SASI_Mm01_00080183 predicted 619
6 SASI_Mm01_00080184 predicted 830
7 SASI_Mm01_00080185 predicted 733
8 SASI_Mm01_00080186 predicted 1332
9 SASI_Mm01_00080187 predicted 1767
10 SASI_Mm01_00080188 predicted 1100
11 SASI_Mm01_00080180 predicted 1581
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198683 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00089296 predicted 1438
2 SASI_Mm01_00089298 predicted 389
3 SASI_Mm01_00089299 predicted 1313
4 SASI_Mm02_00351154 predicted 1598
5 SASI_Mm01_00089300 predicted 467
6 SASI_Mm01_00089301 predicted 681
7 SASI_Mm01_00089302 predicted 584
8 SASI_Mm01_00089303 predicted 1178
9 SASI_Mm01_00089304 predicted 1617
10 SASI_Mm01_00089305 predicted 957
11 SASI_Mm01_00089297 predicted 1422
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198683
VALIDATED
CELF1 MISSION shRNA Bacterial Glycerol Stock
CUGBP, Elav-like family member 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000326898    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198683.1-1739s21c1
Sequence:CCGGCGTCAAGTACATCGTCCAAATCTCGAGATTTGGACGATGTACTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198683.1-1320s21c1
Sequence:CCGGACTCTGTACAACCAGAATTTACTCGAGTAAATTCTGGTTGTACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198683.1-1279s21c1
Sequence:CCGGCGTATTCTGGTATCCAGCAATCTCGAGATTGCTGGATACCAGAATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198683.1-868s21c1
Sequence:CCGGCCCAGTACTTAGCACTTTATTCTCGAGAATAAAGTGCTAAGTACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098510    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198683.1-1739s1c1
Sequence:CCGGCGTCAAGTACATCGTCCAAATCTCGAGATTTGGACGATGTACTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198683.1-868s1c1
Sequence:CCGGCCCAGTACTTAGCACTTTATTCTCGAGAATAAAGTGCTAAGTACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198683.1-869s1c1
Sequence:CCGGCCAGTACTTAGCACTTTATTTCTCGAGAAATAAAGTGCTAAGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198683.1-1320s1c1
Sequence:CCGGACTCTGTACAACCAGAATTTACTCGAGTAAATTCTGGTTGTACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198683.1-1279s1c1
Sequence:CCGGCGTATTCTGGTATCCAGCAATCTCGAGATTGCTGGATACCAGAATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198683
VALIDATED
CELF1 MISSION shRNA shRNA Plasmid DNA
CUGBP, Elav-like family member 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000326898    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198683.1-1739s21c1
Sequence:CCGGCGTCAAGTACATCGTCCAAATCTCGAGATTTGGACGATGTACTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198683.1-1320s21c1
Sequence:CCGGACTCTGTACAACCAGAATTTACTCGAGTAAATTCTGGTTGTACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198683.1-1279s21c1
Sequence:CCGGCGTATTCTGGTATCCAGCAATCTCGAGATTGCTGGATACCAGAATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198683.1-868s21c1
Sequence:CCGGCCCAGTACTTAGCACTTTATTCTCGAGAATAAAGTGCTAAGTACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098510    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198683.1-1739s1c1
Sequence:CCGGCGTCAAGTACATCGTCCAAATCTCGAGATTTGGACGATGTACTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198683.1-868s1c1
Sequence:CCGGCCCAGTACTTAGCACTTTATTCTCGAGAATAAAGTGCTAAGTACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198683.1-869s1c1
Sequence:CCGGCCAGTACTTAGCACTTTATTTCTCGAGAAATAAAGTGCTAAGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198683.1-1320s1c1
Sequence:CCGGACTCTGTACAACCAGAATTTACTCGAGTAAATTCTGGTTGTACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198683.1-1279s1c1
Sequence:CCGGCGTATTCTGGTATCCAGCAATCTCGAGATTGCTGGATACCAGAATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198683
VALIDATED
CELF1 MISSION shRNA Lentiviral Transduction Particles
CUGBP, Elav-like family member 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000326898    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198683.1-1739s21c1
Sequence:CCGGCGTCAAGTACATCGTCCAAATCTCGAGATTTGGACGATGTACTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198683.1-1320s21c1
Sequence:CCGGACTCTGTACAACCAGAATTTACTCGAGTAAATTCTGGTTGTACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198683.1-1279s21c1
Sequence:CCGGCGTATTCTGGTATCCAGCAATCTCGAGATTGCTGGATACCAGAATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198683.1-868s21c1
Sequence:CCGGCCCAGTACTTAGCACTTTATTCTCGAGAATAAAGTGCTAAGTACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098510    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198683.1-1739s1c1
Sequence:CCGGCGTCAAGTACATCGTCCAAATCTCGAGATTTGGACGATGTACTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198683.1-868s1c1
Sequence:CCGGCCCAGTACTTAGCACTTTATTCTCGAGAATAAAGTGCTAAGTACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198683.1-869s1c1
Sequence:CCGGCCAGTACTTAGCACTTTATTTCTCGAGAAATAAAGTGCTAAGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198683.1-1320s1c1
Sequence:CCGGACTCTGTACAACCAGAATTTACTCGAGTAAATTCTGGTTGTACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198683.1-1279s1c1
Sequence:CCGGCGTATTCTGGTATCCAGCAATCTCGAGATTGCTGGATACCAGAATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006560
VALIDATED
CELF1 MISSION shRNA Bacterial Glycerol Stock
CUGBP, Elav-like family member 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000233076    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_006560.2-1690s21c1
Sequence:CCGGCGTCAAGTACATCGTCCAAATCTCGAGATTTGGACGATGTACTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_006560.2-1542s21c1
Sequence:CCGGATTGGCATGAAGCGGCTTAAACTCGAGTTTAAGCCGCTTCATGCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_006560.2-1230s21c1
Sequence:CCGGTACTCGGGTATCCAGCAATATCTCGAGATATTGCTGGATACCCGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_006560.2-554s21c1
Sequence:CCGGGATTGAAGAATGCCGGATATTCTCGAGAATATCCGGCATTCTTCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006560.2-481s21c1
Sequence:CCGGAGCTGTTTATTGGTATGATTTCTCGAGAAATCATACCAATAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006560.2-1554s1c1
Sequence:CCGGCGGCTTAAAGTGCAGCTCAAACTCGAGTTTGAGCTGCACTTTAAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006560.2-192s1c1
Sequence:CCGGCTTGATGCTATCAAGATGTTTCTCGAGAAACATCTTGATAGCATCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_006560.2-1044s1c1
Sequence:CCGGCCTAGCTCTAGCAGCAGTAATCTCGAGATTACTGCTGCTAGAGCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006560.2-366s1c1
Sequence:CCGGGCTGCATTAGAAGCTCAGAATCTCGAGATTCTGAGCTTCTAATGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_006560.2-528s1c1
Sequence:CCGGCGAGTCATGTTCTCTTCGTTTCTCGAGAAACGAAGAGAACATGACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006560
VALIDATED
CELF1 MISSION shRNA shRNA Plasmid DNA
CUGBP, Elav-like family member 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000233076    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_006560.2-1690s21c1
Sequence:CCGGCGTCAAGTACATCGTCCAAATCTCGAGATTTGGACGATGTACTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_006560.2-1542s21c1
Sequence:CCGGATTGGCATGAAGCGGCTTAAACTCGAGTTTAAGCCGCTTCATGCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_006560.2-1230s21c1
Sequence:CCGGTACTCGGGTATCCAGCAATATCTCGAGATATTGCTGGATACCCGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_006560.2-554s21c1
Sequence:CCGGGATTGAAGAATGCCGGATATTCTCGAGAATATCCGGCATTCTTCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006560.2-481s21c1
Sequence:CCGGAGCTGTTTATTGGTATGATTTCTCGAGAAATCATACCAATAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006560.2-1554s1c1
Sequence:CCGGCGGCTTAAAGTGCAGCTCAAACTCGAGTTTGAGCTGCACTTTAAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006560.2-192s1c1
Sequence:CCGGCTTGATGCTATCAAGATGTTTCTCGAGAAACATCTTGATAGCATCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_006560.2-1044s1c1
Sequence:CCGGCCTAGCTCTAGCAGCAGTAATCTCGAGATTACTGCTGCTAGAGCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006560.2-366s1c1
Sequence:CCGGGCTGCATTAGAAGCTCAGAATCTCGAGATTCTGAGCTTCTAATGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_006560.2-528s1c1
Sequence:CCGGCGAGTCATGTTCTCTTCGTTTCTCGAGAAACGAAGAGAACATGACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006560
VALIDATED
CELF1 MISSION shRNA Lentiviral Transduction Particles
CUGBP, Elav-like family member 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000233076    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_006560.2-1690s21c1
Sequence:CCGGCGTCAAGTACATCGTCCAAATCTCGAGATTTGGACGATGTACTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_006560.2-1542s21c1
Sequence:CCGGATTGGCATGAAGCGGCTTAAACTCGAGTTTAAGCCGCTTCATGCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_006560.2-1230s21c1
Sequence:CCGGTACTCGGGTATCCAGCAATATCTCGAGATATTGCTGGATACCCGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_006560.2-554s21c1
Sequence:CCGGGATTGAAGAATGCCGGATATTCTCGAGAATATCCGGCATTCTTCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006560.2-481s21c1
Sequence:CCGGAGCTGTTTATTGGTATGATTTCTCGAGAAATCATACCAATAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006560.2-1554s1c1
Sequence:CCGGCGGCTTAAAGTGCAGCTCAAACTCGAGTTTGAGCTGCACTTTAAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006560.2-192s1c1
Sequence:CCGGCTTGATGCTATCAAGATGTTTCTCGAGAAACATCTTGATAGCATCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_006560.2-1044s1c1
Sequence:CCGGCCTAGCTCTAGCAGCAGTAATCTCGAGATTACTGCTGCTAGAGCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006560.2-366s1c1
Sequence:CCGGGCTGCATTAGAAGCTCAGAATCTCGAGATTCTGAGCTTCTAATGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_006560.2-528s1c1
Sequence:CCGGCGAGTCATGTTCTCTTCGTTTCTCGAGAAACGAAGAGAACATGACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks