EMAIL THIS PAGE TO A FRIEND

CELF2-AS1

CELF2 antisense RNA 1

Synonyms: C10orf31
Species: Human CELF2-AS1(414196)
UniProtKB ID: Q8N7Q2, A6NFV2
Gene ID:
31 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001012713 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001012713 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001012713 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012713 Rosetta Predictions human pricing
XR_041926 Rosetta Predictions human pricing
XR_041927 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012713 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00093799 predicted 611
2 SASI_Hs01_00093800 predicted 762
3 SASI_Hs01_00093801 predicted 568
4 SASI_Hs01_00093802 predicted 779
5 SASI_Hs01_00093803 predicted 659
6 SASI_Hs01_00093804 predicted 774
7 SASI_Hs01_00093805 predicted 1021
8 SASI_Hs01_00093806 predicted 699
9 SASI_Hs01_00093807 predicted 1008
10 SASI_Hs01_00093808 predicted 940
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041926 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00531565 predicted 2333
2 SASI_Hs02_00531566 predicted 760
3 SASI_Hs02_00531567 predicted 1732
4 SASI_Hs02_00531568 predicted 769
5 SASI_Hs02_00531569 predicted 2599
6 SASI_Hs02_00531570 predicted 1804
7 SASI_Hs02_00531571 predicted 2481
8 SASI_Hs02_00531572 predicted 2365
9 SASI_Hs02_00531573 predicted 658
10 SASI_Hs02_00531574 predicted 2346
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041927 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00531575 predicted 2336
2 SASI_Hs02_00531576 predicted 764
3 SASI_Hs02_00531577 predicted 1732
4 SASI_Hs02_00531578 predicted 775
5 SASI_Hs02_00531579 predicted 2605
6 SASI_Hs02_00531580 predicted 1802
7 SASI_Hs02_00531581 predicted 2481
8 SASI_Hs02_00531582 predicted 2368
9 SASI_Hs02_00531583 predicted 658
10 SASI_Hs02_00531584 predicted 2352
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001012713
CELF2-AS1 MISSION shRNA Bacterial Glycerol Stock
CELF2 antisense RNA 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166119    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012713.1-137s1c1
Sequence:CCGGCAGTCCTCTGGAAATGCAGATCTCGAGATCTGCATTTCCAGAGGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165383    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012713.1-512s1c1
Sequence:CCGGCCAACTCCCTTCTTCTGTACACTCGAGTGTACAGAAGAAGGGAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159022    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012713.1-1271s1c1
Sequence:CCGGGTGAAGAAAGTCAAGTTGAATCTCGAGATTCAACTTGACTTTCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160256    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012713.1-1170s1c1
Sequence:CCGGCCTGATGTTGTTCTAGATTAACTCGAGTTAATCTAGAACAACATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165384    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012713.1-519s1c1
Sequence:CCGGCCTTCTTCTGTACACAGCTGTCTCGAGACAGCTGTGTACAGAAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163511    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012713.1-111s1c1
Sequence:CCGGGATTACAGATGATCGCACTCTCTCGAGAGAGTGCGATCATCTGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162487    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012713.1-1345s1c1
Sequence:CCGGCGACCATTTCCTCTCATTTATCTCGAGATAAATGAGAGGAAATGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163055    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012713.1-520s1c1
Sequence:CCGGCTTCTTCTGTACACAGCTGTTCTCGAGAACAGCTGTGTACAGAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163773    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012713.1-660s1c1
Sequence:CCGGGATGGATGTTTCAGAGGGTATCTCGAGATACCCTCTGAAACATCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163945    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012713.1-642s1c1
Sequence:CCGGCCTGCTCTTGAAATACTGGATCTCGAGATCCAGTATTTCAAGAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164050    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012713.1-60s1c1
Sequence:CCGGCCAACTTCGCCTCTTCAATTACTCGAGTAATTGAAGAGGCGAAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001012713
CELF2-AS1 MISSION shRNA shRNA Plasmid DNA
CELF2 antisense RNA 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166119    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012713.1-137s1c1
Sequence:CCGGCAGTCCTCTGGAAATGCAGATCTCGAGATCTGCATTTCCAGAGGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165383    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012713.1-512s1c1
Sequence:CCGGCCAACTCCCTTCTTCTGTACACTCGAGTGTACAGAAGAAGGGAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159022    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012713.1-1271s1c1
Sequence:CCGGGTGAAGAAAGTCAAGTTGAATCTCGAGATTCAACTTGACTTTCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160256    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012713.1-1170s1c1
Sequence:CCGGCCTGATGTTGTTCTAGATTAACTCGAGTTAATCTAGAACAACATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165384    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012713.1-519s1c1
Sequence:CCGGCCTTCTTCTGTACACAGCTGTCTCGAGACAGCTGTGTACAGAAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163511    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012713.1-111s1c1
Sequence:CCGGGATTACAGATGATCGCACTCTCTCGAGAGAGTGCGATCATCTGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162487    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012713.1-1345s1c1
Sequence:CCGGCGACCATTTCCTCTCATTTATCTCGAGATAAATGAGAGGAAATGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163055    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012713.1-520s1c1
Sequence:CCGGCTTCTTCTGTACACAGCTGTTCTCGAGAACAGCTGTGTACAGAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163773    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012713.1-660s1c1
Sequence:CCGGGATGGATGTTTCAGAGGGTATCTCGAGATACCCTCTGAAACATCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163945    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012713.1-642s1c1
Sequence:CCGGCCTGCTCTTGAAATACTGGATCTCGAGATCCAGTATTTCAAGAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164050    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012713.1-60s1c1
Sequence:CCGGCCAACTTCGCCTCTTCAATTACTCGAGTAATTGAAGAGGCGAAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001012713
CELF2-AS1 MISSION shRNA Lentiviral Transduction Particles
CELF2 antisense RNA 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166119    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012713.1-137s1c1
Sequence:CCGGCAGTCCTCTGGAAATGCAGATCTCGAGATCTGCATTTCCAGAGGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165383    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012713.1-512s1c1
Sequence:CCGGCCAACTCCCTTCTTCTGTACACTCGAGTGTACAGAAGAAGGGAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159022    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012713.1-1271s1c1
Sequence:CCGGGTGAAGAAAGTCAAGTTGAATCTCGAGATTCAACTTGACTTTCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160256    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012713.1-1170s1c1
Sequence:CCGGCCTGATGTTGTTCTAGATTAACTCGAGTTAATCTAGAACAACATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165384    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012713.1-519s1c1
Sequence:CCGGCCTTCTTCTGTACACAGCTGTCTCGAGACAGCTGTGTACAGAAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163511    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012713.1-111s1c1
Sequence:CCGGGATTACAGATGATCGCACTCTCTCGAGAGAGTGCGATCATCTGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162487    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012713.1-1345s1c1
Sequence:CCGGCGACCATTTCCTCTCATTTATCTCGAGATAAATGAGAGGAAATGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163055    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012713.1-520s1c1
Sequence:CCGGCTTCTTCTGTACACAGCTGTTCTCGAGAACAGCTGTGTACAGAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163773    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012713.1-660s1c1
Sequence:CCGGGATGGATGTTTCAGAGGGTATCTCGAGATACCCTCTGAAACATCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163945    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012713.1-642s1c1
Sequence:CCGGCCTGCTCTTGAAATACTGGATCTCGAGATCCAGTATTTCAAGAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164050    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012713.1-60s1c1
Sequence:CCGGCCAACTTCGCCTCTTCAATTACTCGAGTAATTGAAGAGGCGAAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks