EMAIL THIS PAGE TO A FRIEND

CELF2

CUGBP, Elav-like family member 2

503 Gene Product Result for
Synonyms: BRUNOL3 CUGBP2 ETR-3 ETR3 NAPOR
Gene ID:
Human(10659) Summary: Members of the CELF/BRUNOL protein family contain two N-terminal RNA recognition motif (RRM) domains, one C-terminal RRM domain, and a divergent segment of 160-230 aa between the second and third RRM domains. Members of this protein family regulate pre-mRNA alternative splicing and may also be involved in mRNA editing, and translation. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(14007) CUGBP, Elav-like family member 2
Rat(29428) CUGBP, Elav-like family member 2
sheep(101107886) CUGBP, Elav-like family member 2
naked mole-rat(101700202) CUGBP, Elav-like family member 2
domestic guinea pig(100724393) CUGBP, Elav-like family member 2
Zebrafish(373117) cugbp, Elav-like family member 2
dog(607310) CUGBP, Elav-like family member 2
domestic cat(101083775) CUGBP, Elav-like family member 2
cow(777790) CUGBP, Elav-like family member 2
Horse(100056973) CUGBP, Elav-like family member 2
chicken(374111) CUGBP, Elav-like family member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA035813 Anti-CELF2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
AV40324 Anti-CUGBP2 antibody produced in rabbit affinity isolated antibody horse, rat, zebrafish, bovine, mouse, guinea pig, human, rabbit, canine
western blot pricing
AV40323 Anti-CUGBP2 antibody produced in rabbit IgG fraction of antiserum mouse, rat, guinea pig, horse, canine, bovine, rabbit, zebrafish, human
immunohistochemistry, western blot pricing
SAB2100506 Anti-CUGBP2 antibody produced in rabbit affinity isolated antibody bovine, human
western blot pricing
SAB1410117 Anti-CUGBP2 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution mouse, human
ELISA, western blot pricing
C9367 Anti-CUGBP2 antibody, Mouse monoclonal clone HL1889 (1H2-1F12), purified from hybridoma cell culture chicken, mouse, human
immunocytochemistry, immunoprecipitation, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010160 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010160 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010160 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006561 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006561 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006561 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU073251 MISSION® esiRNA esiRNA human CUGBP2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001025076 Rosetta Predictions human pricing
NM_001025077 Rosetta Predictions human pricing
NM_001083591 Rosetta Predictions human pricing
NM_006561 Rosetta Predictions human pricing
NM_001083586 Rosetta Predictions rat pricing
NM_017197 Rosetta Predictions rat pricing
NM_001110228 Rosetta Predictions mouse pricing
NM_001110229 Rosetta Predictions mouse pricing
NM_001110230 Rosetta Predictions mouse pricing
NM_001110231 Rosetta Predictions mouse pricing
NM_001110232 Rosetta Predictions mouse pricing
NM_010160 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025076 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00051598 predicted 529
2 SASI_Hs01_00051600 predicted 833
3 SASI_Hs01_00051601 predicted 970
4 SASI_Hs01_00051603 predicted 1007
5 SASI_Hs01_00051604 predicted 1554
6 SASI_Hs01_00051605 predicted 686
7 SASI_Hs02_00307320 predicted 525
8 SASI_Hs01_00051606 predicted 1564
9 SASI_Hs01_00051607 predicted 733
10 SASI_Hs02_00307321 predicted 776
11 SASI_Hs01_00051599 predicted 1535
12 SASI_Hs01_00051602 predicted 598
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025077 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00190567 predicted 387
2 SASI_Hs01_00190569 predicted 690
3 SASI_Hs01_00190570 predicted 832
4 SASI_Hs01_00190572 predicted 868
5 SASI_Hs01_00190573 predicted 1386
6 SASI_Hs01_00190574 predicted 544
7 SASI_Hs02_00307322 predicted 385
8 SASI_Hs01_00190575 predicted 1398
9 SASI_Hs01_00190576 predicted 596
10 SASI_Hs02_00307323 predicted 628
11 SASI_Hs01_00190568 predicted 1409
12 SASI_Hs01_00190571 predicted 488
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083591 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317001 predicted 527
2 SASI_Hs02_00317002 predicted 841
3 SASI_Hs02_00317003 predicted 969
4 SASI_Hs02_00317004 predicted 1008
5 SASI_Hs02_00317005 predicted 1544
6 SASI_Hs02_00317006 predicted 690
7 SASI_Hs02_00317007 predicted 529
8 SASI_Hs02_00317008 predicted 1556
9 SASI_Hs02_00317009 predicted 741
10 SASI_Hs02_00317010 predicted 777
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006561 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00204918 predicted 473
2 SASI_Hs01_00204920 predicted 781
3 SASI_Hs01_00204921 predicted 921
4 SASI_Hs01_00204923 predicted 959
5 SASI_Hs01_00204924 predicted 1500
6 SASI_Hs01_00204925 predicted 633
7 SASI_Hs02_00341832 predicted 473
8 SASI_Hs01_00204926 predicted 1509
9 SASI_Hs01_00204927 predicted 680
10 SASI_Hs02_00341833 predicted 724
11 SASI_Hs01_00204919 predicted 1505
12 SASI_Hs01_00204922 predicted 562
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083586 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00208889 predicted 868
2 SASI_Rn02_00208890 predicted 842
3 SASI_Rn02_00208891 predicted 356
4 SASI_Rn02_00208892 predicted 1396
5 SASI_Rn02_00208893 predicted 310
6 SASI_Rn02_00208894 predicted 881
7 SASI_Rn02_00208895 predicted 804
8 SASI_Rn02_00208896 predicted 667
9 SASI_Rn02_00208897 predicted 1368
10 SASI_Rn02_00208898 predicted 675
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017197 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00035311 predicted 1086
2 SASI_Rn02_00261552 predicted 1053
3 SASI_Rn01_00035312 predicted 576
4 SASI_Rn02_00261553 predicted 1627
5 SASI_Rn01_00035313 predicted 519
6 SASI_Rn01_00035314 predicted 1096
7 SASI_Rn01_00035315 predicted 1021
8 SASI_Rn01_00035318 predicted 880
9 SASI_Rn02_00261554 predicted 1592
10 SASI_Rn02_00261555 predicted 885
11 SASI_Rn01_00035316 predicted 1543
12 SASI_Rn01_00035317 predicted 1129
13 SASI_Rn01_00035319 predicted 1446
14 SASI_Rn01_00035320 predicted 1687
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110228 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00305056 predicted 870
2 SASI_Mm02_00305057 predicted 834
3 SASI_Mm02_00305058 predicted 385
4 SASI_Mm02_00305059 predicted 434
5 SASI_Mm02_00305060 predicted 498
6 SASI_Mm02_00305061 predicted 550
7 SASI_Mm02_00305062 predicted 906
8 SASI_Mm02_00305063 predicted 505
9 SASI_Mm02_00305064 predicted 630
10 SASI_Mm02_00305065 predicted 920
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110229 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00305066 predicted 955
2 SASI_Mm02_00305067 predicted 919
3 SASI_Mm02_00305068 predicted 478
4 SASI_Mm02_00305069 predicted 523
5 SASI_Mm02_00305070 predicted 578
6 SASI_Mm02_00305071 predicted 632
7 SASI_Mm02_00305072 predicted 993
8 SASI_Mm02_00305073 predicted 596
9 SASI_Mm02_00305074 predicted 724
10 SASI_Mm02_00305075 predicted 1006
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110230 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00305076 predicted 955
2 SASI_Mm02_00305077 predicted 918
3 SASI_Mm02_00305078 predicted 469
4 SASI_Mm02_00305079 predicted 519
5 SASI_Mm02_00305080 predicted 582
6 SASI_Mm02_00305081 predicted 634
7 SASI_Mm02_00305082 predicted 993
8 SASI_Mm02_00305083 predicted 596
9 SASI_Mm02_00305084 predicted 719
10 SASI_Mm02_00305085 predicted 1011
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110231 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00305086 predicted 929
2 SASI_Mm02_00305087 predicted 896
3 SASI_Mm02_00305088 predicted 451
4 SASI_Mm02_00305089 predicted 500
5 SASI_Mm02_00305090 predicted 557
6 SASI_Mm02_00305091 predicted 607
7 SASI_Mm02_00305092 predicted 970
8 SASI_Mm02_00305093 predicted 567
9 SASI_Mm02_00305094 predicted 690
10 SASI_Mm02_00305095 predicted 986
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110232 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00305096 predicted 935
2 SASI_Mm02_00305097 predicted 900
3 SASI_Mm02_00305098 predicted 460
4 SASI_Mm02_00305099 predicted 505
5 SASI_Mm02_00305100 predicted 571
6 SASI_Mm02_00305101 predicted 620
7 SASI_Mm02_00305102 predicted 986
8 SASI_Mm02_00305103 predicted 575
9 SASI_Mm02_00305104 predicted 701
10 SASI_Mm02_00305105 predicted 997
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010160 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00317920 predicted 862
2 SASI_Mm02_00317921 predicted 827
3 SASI_Mm01_00088617 predicted 385
4 SASI_Mm01_00088619 predicted 440
5 SASI_Mm02_00317922 predicted 491
6 SASI_Mm02_00317923 predicted 552
7 SASI_Mm01_00088620 predicted 910
8 SASI_Mm01_00088623 predicted 507
9 SASI_Mm02_00317924 predicted 633
10 SASI_Mm02_00317925 predicted 927
11 SASI_Mm01_00088618 predicted 1410
12 SASI_Mm01_00088621 predicted 1431
13 SASI_Mm01_00088622 predicted 1363
14 SASI_Mm01_00088624 predicted 1338
15 SASI_Mm01_00088625 predicted 1583
16 SASI_Mm01_00088626 predicted 1139
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010160
VALIDATED
CELF2 MISSION shRNA Bacterial Glycerol Stock
CUGBP, Elav-like family member 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010160.1-305s1c1
Sequence:CCGGCCAGAGTAAAGGTTGTTGTTTCTCGAGAAACAACAACCTTTACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098675    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010160.1-5173s1c1
Sequence:CCGGGCGGTAAGTTTCACTCTTTATCTCGAGATAAAGAGTGAAACTTACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010160.1-131s1c1
Sequence:CCGGCAACAAGATGAACGGAGCTTTCTCGAGAAAGCTCCGTTCATCTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010160.1-497s1c1
Sequence:CCGGCGAGAATGATATCAGAGTGATCTCGAGATCACTCTGATATCATTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010160.1-470s1c1
Sequence:CCGGCATAGGAATGGTTTCCAAGAACTCGAGTTCTTGGAAACCATTCCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010160
VALIDATED
CELF2 MISSION shRNA shRNA Plasmid DNA
CUGBP, Elav-like family member 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010160.1-305s1c1
Sequence:CCGGCCAGAGTAAAGGTTGTTGTTTCTCGAGAAACAACAACCTTTACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098675    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010160.1-5173s1c1
Sequence:CCGGGCGGTAAGTTTCACTCTTTATCTCGAGATAAAGAGTGAAACTTACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010160.1-131s1c1
Sequence:CCGGCAACAAGATGAACGGAGCTTTCTCGAGAAAGCTCCGTTCATCTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010160.1-497s1c1
Sequence:CCGGCGAGAATGATATCAGAGTGATCTCGAGATCACTCTGATATCATTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010160.1-470s1c1
Sequence:CCGGCATAGGAATGGTTTCCAAGAACTCGAGTTCTTGGAAACCATTCCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010160
VALIDATED
CELF2 MISSION shRNA Lentiviral Transduction Particles
CUGBP, Elav-like family member 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010160.1-305s1c1
Sequence:CCGGCCAGAGTAAAGGTTGTTGTTTCTCGAGAAACAACAACCTTTACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098675    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010160.1-5173s1c1
Sequence:CCGGGCGGTAAGTTTCACTCTTTATCTCGAGATAAAGAGTGAAACTTACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010160.1-131s1c1
Sequence:CCGGCAACAAGATGAACGGAGCTTTCTCGAGAAAGCTCCGTTCATCTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010160.1-497s1c1
Sequence:CCGGCGAGAATGATATCAGAGTGATCTCGAGATCACTCTGATATCATTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010160.1-470s1c1
Sequence:CCGGCATAGGAATGGTTTCCAAGAACTCGAGTTCTTGGAAACCATTCCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006561
CELF2 MISSION shRNA Bacterial Glycerol Stock
CUGBP, Elav-like family member 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006561.1-315s1c1
Sequence:CCGGCCCAGAATGCACTGCACAATACTCGAGTATTGTGCAGTGCATTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074613    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006561.1-2134s1c1
Sequence:CCGGGCTCACTTTCTCATTAAGATACTCGAGTATCTTAATGAGAAAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006561.1-1059s1c1
Sequence:CCGGCCACTGTTGGACTGAATAATACTCGAGTATTATTCAGTCCAACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006561.1-258s1c1
Sequence:CCGGCGCAGAGTAAAGGTTGTTGTTCTCGAGAACAACAACCTTTACTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006561.1-1501s1c1
Sequence:CCGGGATCGGCATGAAACGCTTGAACTCGAGTTCAAGCGTTTCATGCCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006561.3-431s21c1
Sequence:CCGGGGTTGTTGTTTCGTAACATTTCTCGAGAAATGTTACGAAACAACAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006561.3-480s21c1
Sequence:CCGGAGAATGCACTGCACAATATTACTCGAGTAATATTGTGCAGTGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006561.3-588s21c1
Sequence:CCGGTAGGAATGGTATCGAAGAAATCTCGAGATTTCTTCGATACCATTCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236113    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006561.3-5971s21c1
Sequence:CCGGTTTGACCACACAGGTTAATTTCTCGAGAAATTAACCTGTGTGGTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006561.3-218s21c1
Sequence:CCGGCTCGTTCCTGACAGAATTAACCTCGAGGTTAATTCTGTCAGGAACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006561
CELF2 MISSION shRNA shRNA Plasmid DNA
CUGBP, Elav-like family member 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006561.1-315s1c1
Sequence:CCGGCCCAGAATGCACTGCACAATACTCGAGTATTGTGCAGTGCATTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074613    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006561.1-2134s1c1
Sequence:CCGGGCTCACTTTCTCATTAAGATACTCGAGTATCTTAATGAGAAAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006561.1-1059s1c1
Sequence:CCGGCCACTGTTGGACTGAATAATACTCGAGTATTATTCAGTCCAACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006561.1-258s1c1
Sequence:CCGGCGCAGAGTAAAGGTTGTTGTTCTCGAGAACAACAACCTTTACTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006561.1-1501s1c1
Sequence:CCGGGATCGGCATGAAACGCTTGAACTCGAGTTCAAGCGTTTCATGCCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006561.3-431s21c1
Sequence:CCGGGGTTGTTGTTTCGTAACATTTCTCGAGAAATGTTACGAAACAACAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006561.3-480s21c1
Sequence:CCGGAGAATGCACTGCACAATATTACTCGAGTAATATTGTGCAGTGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006561.3-588s21c1
Sequence:CCGGTAGGAATGGTATCGAAGAAATCTCGAGATTTCTTCGATACCATTCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236113    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006561.3-5971s21c1
Sequence:CCGGTTTGACCACACAGGTTAATTTCTCGAGAAATTAACCTGTGTGGTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006561.3-218s21c1
Sequence:CCGGCTCGTTCCTGACAGAATTAACCTCGAGGTTAATTCTGTCAGGAACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006561
CELF2 MISSION shRNA Lentiviral Transduction Particles
CUGBP, Elav-like family member 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006561.1-315s1c1
Sequence:CCGGCCCAGAATGCACTGCACAATACTCGAGTATTGTGCAGTGCATTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074613    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006561.1-2134s1c1
Sequence:CCGGGCTCACTTTCTCATTAAGATACTCGAGTATCTTAATGAGAAAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006561.1-1059s1c1
Sequence:CCGGCCACTGTTGGACTGAATAATACTCGAGTATTATTCAGTCCAACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006561.1-258s1c1
Sequence:CCGGCGCAGAGTAAAGGTTGTTGTTCTCGAGAACAACAACCTTTACTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006561.1-1501s1c1
Sequence:CCGGGATCGGCATGAAACGCTTGAACTCGAGTTCAAGCGTTTCATGCCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006561.3-431s21c1
Sequence:CCGGGGTTGTTGTTTCGTAACATTTCTCGAGAAATGTTACGAAACAACAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006561.3-480s21c1
Sequence:CCGGAGAATGCACTGCACAATATTACTCGAGTAATATTGTGCAGTGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006561.3-588s21c1
Sequence:CCGGTAGGAATGGTATCGAAGAAATCTCGAGATTTCTTCGATACCATTCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236113    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006561.3-5971s21c1
Sequence:CCGGTTTGACCACACAGGTTAATTTCTCGAGAAATTAACCTGTGTGGTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006561.3-218s21c1
Sequence:CCGGCTCGTTCCTGACAGAATTAACCTCGAGGTTAATTCTGTCAGGAACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks