EMAIL THIS PAGE TO A FRIEND

CELF3

CUGBP, Elav-like family member 3

125 Gene Product Result for
Synonyms: BRUNOL1 CAGH4 ERDA4 TNRC4
Gene ID:
Human(11189) Summary: Members of the CELF/BRUNOL protein family contain two N-terminal RNA recognition motif (RRM) domains, one C-terminal RRM domain, and a divergent segment of 160-230 aa between the second and third RRM domains. Members of this protein family regulate pre-mRNA alternative splicing and may also be involved in mRNA editing, and translation. Multiple alternatively spliced transcript variants encoding different isoforms have been identified in this gene. [provided by RefSeq, Feb 2010]
Mouse(78784) CUGBP, Elav-like family member 3
Rat(499669) CUGBP, Elav-like family member 3
chicken(431347) CUGBP, Elav-like family member 3
domestic cat(101101654) CUGBP, Elav-like family member 3
cow(513347) CUGBP, Elav-like family member 3
Horse(100055556) CUGBP, Elav-like family member 3
dog(483201) CUGBP, Elav-like family member 3
domestic guinea pig(100735879) CUGBP, Elav-like family member 3
naked mole-rat(101725558) CUGBP, Elav-like family member 3
sheep(101118582) CUGBP, Elav-like family member 3
Domestic Rabbit(100328677) CUGBP, Elav-like family member 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007185 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007185 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007185 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172434 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172434 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172434 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU216721 MISSION® esiRNA esiRNA targeting mouse Celf3 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007185 Rosetta Predictions human pricing
NM_001109190 Rosetta Predictions rat pricing
NM_172434 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007185 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00087539 predicted 1106
2 SASI_Hs01_00087540 predicted 2662
3 SASI_Hs01_00087541 predicted 2128
4 SASI_Hs01_00087542 predicted 899
5 SASI_Hs01_00087543 predicted 2196
6 SASI_Hs01_00087544 predicted 1060
7 SASI_Hs01_00087545 predicted 2671
8 SASI_Hs01_00087546 predicted 1242
9 SASI_Hs01_00087547 predicted 945
10 SASI_Hs01_00087548 predicted 1497
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109190 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00246010 predicted 1039
2 SASI_Rn02_00246011 predicted 1948
3 SASI_Rn02_00246012 predicted 1230
4 SASI_Rn02_00246013 predicted 894
5 SASI_Rn02_00246014 predicted 1978
6 SASI_Rn02_00246015 predicted 719
7 SASI_Rn02_00246016 predicted 1145
8 SASI_Rn02_00246017 predicted 1280
9 SASI_Rn02_00246018 predicted 1015
10 SASI_Rn02_00246019 predicted 1954
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172434 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00182911 predicted 934
2 SASI_Mm01_00182912 predicted 1661
3 SASI_Mm01_00182913 predicted 755
4 SASI_Mm01_00182914 predicted 744
5 SASI_Mm02_00343921 predicted 614
6 SASI_Mm01_00182915 predicted 433
7 SASI_Mm01_00182916 predicted 592
8 SASI_Mm01_00182917 predicted 539
9 SASI_Mm01_00182918 predicted 557
10 SASI_Mm01_00182919 predicted 993
11 SASI_Mm01_00182920 predicted 1619
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007185
CELF3 MISSION shRNA Bacterial Glycerol Stock
CUGBP, Elav-like family member 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005727    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007185.2-2665s1c1
Sequence:CCGGCCTCAGCTAGAGGTAGGATATCTCGAGATATCCTACCTCTAGCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007185.2-2005s1c1
Sequence:CCGGCGTCATCTCAGCCAAAGTCTTCTCGAGAAGACTTTGGCTGAGATGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007185.2-2137s1c1
Sequence:CCGGGCGCCTCAAAGTCCAGCTAAACTCGAGTTTAGCTGGACTTTGAGGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007185.2-895s1c1
Sequence:CCGGGCTGACTGTCATCAAGGACAACTCGAGTTGTCCTTGATGACAGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007185.3-2033s21c1
Sequence:CCGGTGACCGAGCCACCAATCAAAGCTCGAGCTTTGATTGGTGGCTCGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007185.3-2065s21c1
Sequence:CCGGGCTTTGTGAGTTTCGACAATCCTCGAGGATTGTCGAAACTCACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007185.3-1069s21c1
Sequence:CCGGGAGAAGACCGGAAGCTCTTTGCTCGAGCAAAGAGCTTCCGGTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007185.3-876s21c1
Sequence:CCGGGAACAGTTTGGTCGGATCTTTCTCGAGAAAGATCCGACCAAACTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007185.3-1120s21c1
Sequence:CCGGAGGACGTCCGGAAGATGTTTGCTCGAGCAAACATCTTCCGGACGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007185
CELF3 MISSION shRNA shRNA Plasmid DNA
CUGBP, Elav-like family member 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005727    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007185.2-2665s1c1
Sequence:CCGGCCTCAGCTAGAGGTAGGATATCTCGAGATATCCTACCTCTAGCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007185.2-2005s1c1
Sequence:CCGGCGTCATCTCAGCCAAAGTCTTCTCGAGAAGACTTTGGCTGAGATGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007185.2-2137s1c1
Sequence:CCGGGCGCCTCAAAGTCCAGCTAAACTCGAGTTTAGCTGGACTTTGAGGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007185.2-895s1c1
Sequence:CCGGGCTGACTGTCATCAAGGACAACTCGAGTTGTCCTTGATGACAGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007185.3-2033s21c1
Sequence:CCGGTGACCGAGCCACCAATCAAAGCTCGAGCTTTGATTGGTGGCTCGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007185.3-2065s21c1
Sequence:CCGGGCTTTGTGAGTTTCGACAATCCTCGAGGATTGTCGAAACTCACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007185.3-1069s21c1
Sequence:CCGGGAGAAGACCGGAAGCTCTTTGCTCGAGCAAAGAGCTTCCGGTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007185.3-876s21c1
Sequence:CCGGGAACAGTTTGGTCGGATCTTTCTCGAGAAAGATCCGACCAAACTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007185.3-1120s21c1
Sequence:CCGGAGGACGTCCGGAAGATGTTTGCTCGAGCAAACATCTTCCGGACGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007185
CELF3 MISSION shRNA Lentiviral Transduction Particles
CUGBP, Elav-like family member 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005727    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007185.2-2665s1c1
Sequence:CCGGCCTCAGCTAGAGGTAGGATATCTCGAGATATCCTACCTCTAGCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007185.2-2005s1c1
Sequence:CCGGCGTCATCTCAGCCAAAGTCTTCTCGAGAAGACTTTGGCTGAGATGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007185.2-2137s1c1
Sequence:CCGGGCGCCTCAAAGTCCAGCTAAACTCGAGTTTAGCTGGACTTTGAGGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007185.2-895s1c1
Sequence:CCGGGCTGACTGTCATCAAGGACAACTCGAGTTGTCCTTGATGACAGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007185.3-2033s21c1
Sequence:CCGGTGACCGAGCCACCAATCAAAGCTCGAGCTTTGATTGGTGGCTCGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007185.3-2065s21c1
Sequence:CCGGGCTTTGTGAGTTTCGACAATCCTCGAGGATTGTCGAAACTCACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007185.3-1069s21c1
Sequence:CCGGGAGAAGACCGGAAGCTCTTTGCTCGAGCAAAGAGCTTCCGGTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007185.3-876s21c1
Sequence:CCGGGAACAGTTTGGTCGGATCTTTCTCGAGAAAGATCCGACCAAACTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007185.3-1120s21c1
Sequence:CCGGAGGACGTCCGGAAGATGTTTGCTCGAGCAAACATCTTCCGGACGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172434
CELF3 MISSION shRNA Bacterial Glycerol Stock
CUGBP, Elav-like family member 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098695    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172434.1-1870s1c1
Sequence:CCGGCCTGGCTTCAAGAGCCTATTTCTCGAGAAATAGGCTCTTGAAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172434.1-1464s1c1
Sequence:CCGGCCTCCAGATGTTTGTCCCTTTCTCGAGAAAGGGACAAACATCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172434.1-615s1c1
Sequence:CCGGGTTTGAACCATTTGGGACTATCTCGAGATAGTCCCAAATGGTTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172434.1-375s1c1
Sequence:CCGGCTTCGAGCTGACTGTCATCAACTCGAGTTGATGACAGTCAGCTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172434.1-1236s1c1
Sequence:CCGGCTATGCAGGAATGCAGCACTACTCGAGTAGTGCTGCATTCCTGCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172434.2-1655s21c1
Sequence:CCGGATGCAAACAGGCCCTACTAAGCTCGAGCTTAGTAGGGCCTGTTTGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172434.2-347s21c1
Sequence:CCGGAGCCCATCTTCGAGCAGTTTGCTCGAGCAAACTGCTCGAAGATGGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172434.2-1547s21c1
Sequence:CCGGGCTTTGTGAGTTTCGACAATCCTCGAGGATTGTCGAAACTCACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172434.2-1623s21c1
Sequence:CCGGGCGCCTCAAAGTCCAGCTAAACTCGAGTTTAGCTGGACTTTGAGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172434
CELF3 MISSION shRNA shRNA Plasmid DNA
CUGBP, Elav-like family member 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098695    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172434.1-1870s1c1
Sequence:CCGGCCTGGCTTCAAGAGCCTATTTCTCGAGAAATAGGCTCTTGAAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172434.1-1464s1c1
Sequence:CCGGCCTCCAGATGTTTGTCCCTTTCTCGAGAAAGGGACAAACATCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172434.1-615s1c1
Sequence:CCGGGTTTGAACCATTTGGGACTATCTCGAGATAGTCCCAAATGGTTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172434.1-375s1c1
Sequence:CCGGCTTCGAGCTGACTGTCATCAACTCGAGTTGATGACAGTCAGCTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172434.1-1236s1c1
Sequence:CCGGCTATGCAGGAATGCAGCACTACTCGAGTAGTGCTGCATTCCTGCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172434.2-1655s21c1
Sequence:CCGGATGCAAACAGGCCCTACTAAGCTCGAGCTTAGTAGGGCCTGTTTGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172434.2-347s21c1
Sequence:CCGGAGCCCATCTTCGAGCAGTTTGCTCGAGCAAACTGCTCGAAGATGGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172434.2-1547s21c1
Sequence:CCGGGCTTTGTGAGTTTCGACAATCCTCGAGGATTGTCGAAACTCACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172434.2-1623s21c1
Sequence:CCGGGCGCCTCAAAGTCCAGCTAAACTCGAGTTTAGCTGGACTTTGAGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172434
CELF3 MISSION shRNA Lentiviral Transduction Particles
CUGBP, Elav-like family member 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098695    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172434.1-1870s1c1
Sequence:CCGGCCTGGCTTCAAGAGCCTATTTCTCGAGAAATAGGCTCTTGAAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172434.1-1464s1c1
Sequence:CCGGCCTCCAGATGTTTGTCCCTTTCTCGAGAAAGGGACAAACATCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172434.1-615s1c1
Sequence:CCGGGTTTGAACCATTTGGGACTATCTCGAGATAGTCCCAAATGGTTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172434.1-375s1c1
Sequence:CCGGCTTCGAGCTGACTGTCATCAACTCGAGTTGATGACAGTCAGCTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172434.1-1236s1c1
Sequence:CCGGCTATGCAGGAATGCAGCACTACTCGAGTAGTGCTGCATTCCTGCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172434.2-1655s21c1
Sequence:CCGGATGCAAACAGGCCCTACTAAGCTCGAGCTTAGTAGGGCCTGTTTGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172434.2-347s21c1
Sequence:CCGGAGCCCATCTTCGAGCAGTTTGCTCGAGCAAACTGCTCGAAGATGGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172434.2-1547s21c1
Sequence:CCGGGCTTTGTGAGTTTCGACAATCCTCGAGGATTGTCGAAACTCACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172434.2-1623s21c1
Sequence:CCGGGCGCCTCAAAGTCCAGCTAAACTCGAGTTTAGCTGGACTTTGAGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks