EMAIL THIS PAGE TO A FRIEND

CELF4

CUGBP, Elav-like family member 4

78 Gene Product Result for
Synonyms: BRUNOL-4 BRUNOL4
Gene ID:
Human(56853) Summary: Members of the CELF/BRUNOL protein family contain two N-terminal RNA recognition motif (RRM) domains, one C-terminal RRM domain, and a divergent segment of 160-230 aa between the second and third RRM domains. Members of this protein family regulate pre-mRNA alternative splicing and may also be involved in mRNA editing, and translation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(108013) CUGBP, Elav-like family member 4
Rat(307540) CUGBP, Elav-like family member 4
Zebrafish(436835) CUGBP, Elav-like family member 4
chicken(426889) CUGBP, Elav-like family member 4
domestic cat(101098586) CUGBP, Elav-like family member 4
cow(535177) CUGBP, Elav-like family member 4
dog(610838) CUGBP, Elav-like family member 4
sheep(101114837) CUGBP, Elav-like family member 4
Domestic Rabbit(100354032) CUGBP, Elav-like family member 4
naked mole-rat(101717571) CUGBP, Elav-like family member 4
domestic guinea pig(100732038) CUGBP, Elav-like family member 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020180 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020180 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020180 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133195 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133195 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133195 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001025087 Rosetta Predictions human pricing
NM_001025088 Rosetta Predictions human pricing
NM_001025089 Rosetta Predictions human pricing
NM_020180 Rosetta Predictions human pricing
NM_001107400 Rosetta Predictions rat pricing
NM_133195 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025087 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00307326 predicted 1278
2 SASI_Hs02_00307327 predicted 432
3 SASI_Hs02_00307328 predicted 1972
4 SASI_Hs02_00307329 predicted 1979
5 SASI_Hs02_00307330 predicted 1567
6 SASI_Hs02_00307331 predicted 1963
7 SASI_Hs02_00307332 predicted 1899
8 SASI_Hs02_00307333 predicted 519
9 SASI_Hs02_00307334 predicted 1893
10 SASI_Hs02_00307335 predicted 1096
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025088 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00307336 predicted 1280
2 SASI_Hs02_00307337 predicted 429
3 SASI_Hs02_00307338 predicted 1968
4 SASI_Hs02_00307339 predicted 1974
5 SASI_Hs02_00307340 predicted 1565
6 SASI_Hs02_00307341 predicted 1964
7 SASI_Hs02_00307342 predicted 1893
8 SASI_Hs02_00307343 predicted 525
9 SASI_Hs02_00307344 predicted 1897
10 SASI_Hs02_00307345 predicted 1094
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025089 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00307346 predicted 1249
2 SASI_Hs02_00307347 predicted 430
3 SASI_Hs02_00307348 predicted 1856
4 SASI_Hs02_00307349 predicted 1863
5 SASI_Hs02_00307350 predicted 1540
6 SASI_Hs02_00307351 predicted 1848
7 SASI_Hs02_00307352 predicted 1779
8 SASI_Hs02_00307353 predicted 518
9 SASI_Hs02_00307354 predicted 1788
10 SASI_Hs02_00307355 predicted 1065
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020180 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00098122 predicted 1286
2 SASI_Hs02_00353094 predicted 430
3 SASI_Hs01_00098124 predicted 1976
4 SASI_Hs01_00098125 predicted 1975
5 SASI_Hs01_00098127 predicted 1573
6 SASI_Hs01_00098128 predicted 1963
7 SASI_Hs01_00098129 predicted 1897
8 SASI_Hs02_00353095 predicted 517
9 SASI_Hs01_00098130 predicted 1898
10 SASI_Hs01_00098131 predicted 1093
11 SASI_Hs01_00098123 predicted 1074
12 SASI_Hs01_00098126 predicted 1746
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107400 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00228445 predicted 1083
2 SASI_Rn02_00228446 predicted 864
3 SASI_Rn02_00228447 predicted 1259
4 SASI_Rn02_00228448 predicted 1369
5 SASI_Rn02_00228449 predicted 1706
6 SASI_Rn02_00228450 predicted 694
7 SASI_Rn02_00228451 predicted 1509
8 SASI_Rn02_00228452 predicted 1030
9 SASI_Rn02_00228453 predicted 1031
10 SASI_Rn02_00228454 predicted 1086
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133195 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00144030 predicted 1420
2 SASI_Mm02_00338381 predicted 2202
3 SASI_Mm01_00144032 predicted 2037
4 SASI_Mm01_00144033 predicted 1840
5 SASI_Mm01_00144034 predicted 1366
6 SASI_Mm01_00144035 predicted 1592
7 SASI_Mm01_00144036 predicted 2335
8 SASI_Mm01_00144037 predicted 760
9 SASI_Mm01_00144038 predicted 2105
10 SASI_Mm01_00144039 predicted 1705
11 SASI_Mm01_00144031 predicted 1952
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020180
CELF4 MISSION shRNA Bacterial Glycerol Stock
CUGBP, Elav-like family member 4
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020180.3-975s21c1
Sequence:CCGGGTGCGCCTTTGTGAAGTACTCCTCGAGGAGTACTTCACAAAGGCGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423355    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020180.3-1932s21c1
Sequence:CCGGACAAACCTCTCTCTATATATACTCGAGTATATATAGAGAGAGGTTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020180.1-89s1c1
Sequence:CCGGCCGGGCACATGAACGGATTAACTCGAGTTAATCCGTTCATGTGCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020180.1-154s1c1
Sequence:CCGGGATGCCATCAAGCTGTTCATTCTCGAGAATGAACAGCTTGATGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020180.1-1178s1c1
Sequence:CCGGCTGCTGCCTATGGTCAGATAACTCGAGTTATCTGACCATAGGCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020180.1-162s1c1
Sequence:CCGGCAAGCTGTTCATTGGGCAGATCTCGAGATCTGCCCAATGAACAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020180.1-1302s1c1
Sequence:CCGGCGCTGAGCTGATGCAGATGTTCTCGAGAACATCTGCATCAGCTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020180
CELF4 MISSION shRNA shRNA Plasmid DNA
CUGBP, Elav-like family member 4
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020180.3-975s21c1
Sequence:CCGGGTGCGCCTTTGTGAAGTACTCCTCGAGGAGTACTTCACAAAGGCGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423355    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020180.3-1932s21c1
Sequence:CCGGACAAACCTCTCTCTATATATACTCGAGTATATATAGAGAGAGGTTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020180.1-89s1c1
Sequence:CCGGCCGGGCACATGAACGGATTAACTCGAGTTAATCCGTTCATGTGCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020180.1-154s1c1
Sequence:CCGGGATGCCATCAAGCTGTTCATTCTCGAGAATGAACAGCTTGATGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020180.1-1178s1c1
Sequence:CCGGCTGCTGCCTATGGTCAGATAACTCGAGTTATCTGACCATAGGCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020180.1-162s1c1
Sequence:CCGGCAAGCTGTTCATTGGGCAGATCTCGAGATCTGCCCAATGAACAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020180.1-1302s1c1
Sequence:CCGGCGCTGAGCTGATGCAGATGTTCTCGAGAACATCTGCATCAGCTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020180
CELF4 MISSION shRNA Lentiviral Transduction Particles
CUGBP, Elav-like family member 4
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020180.3-975s21c1
Sequence:CCGGGTGCGCCTTTGTGAAGTACTCCTCGAGGAGTACTTCACAAAGGCGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423355    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020180.3-1932s21c1
Sequence:CCGGACAAACCTCTCTCTATATATACTCGAGTATATATAGAGAGAGGTTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020180.1-89s1c1
Sequence:CCGGCCGGGCACATGAACGGATTAACTCGAGTTAATCCGTTCATGTGCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020180.1-154s1c1
Sequence:CCGGGATGCCATCAAGCTGTTCATTCTCGAGAATGAACAGCTTGATGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020180.1-1178s1c1
Sequence:CCGGCTGCTGCCTATGGTCAGATAACTCGAGTTATCTGACCATAGGCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020180.1-162s1c1
Sequence:CCGGCAAGCTGTTCATTGGGCAGATCTCGAGATCTGCCCAATGAACAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020180.1-1302s1c1
Sequence:CCGGCGCTGAGCTGATGCAGATGTTCTCGAGAACATCTGCATCAGCTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133195
CELF4 MISSION shRNA Bacterial Glycerol Stock
CUGBP, Elav-like family member 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098600    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133195.1-2110s1c1
Sequence:CCGGCCTTTGACATATCAGCCAATACTCGAGTATTGGCTGATATGTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133195.1-622s1c1
Sequence:CCGGCCGGGCATATGAACGGATTAACTCGAGTTAATCCGTTCATATGCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133195.1-1149s1c1
Sequence:CCGGGCCGCCATCAACGCTCTACATCTCGAGATGTAGAGCGTTGATGGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133195.1-1781s1c1
Sequence:CCGGCGAGGGCTGTAACCTGCTCATCTCGAGATGAGCAGGTTACAGCCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133195.1-1705s1c1
Sequence:CCGGCTGCTGCCTATGGTCAGATTACTCGAGTAATCTGACCATAGGCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133195
CELF4 MISSION shRNA shRNA Plasmid DNA
CUGBP, Elav-like family member 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098600    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133195.1-2110s1c1
Sequence:CCGGCCTTTGACATATCAGCCAATACTCGAGTATTGGCTGATATGTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133195.1-622s1c1
Sequence:CCGGCCGGGCATATGAACGGATTAACTCGAGTTAATCCGTTCATATGCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133195.1-1149s1c1
Sequence:CCGGGCCGCCATCAACGCTCTACATCTCGAGATGTAGAGCGTTGATGGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133195.1-1781s1c1
Sequence:CCGGCGAGGGCTGTAACCTGCTCATCTCGAGATGAGCAGGTTACAGCCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133195.1-1705s1c1
Sequence:CCGGCTGCTGCCTATGGTCAGATTACTCGAGTAATCTGACCATAGGCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133195
CELF4 MISSION shRNA Lentiviral Transduction Particles
CUGBP, Elav-like family member 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098600    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133195.1-2110s1c1
Sequence:CCGGCCTTTGACATATCAGCCAATACTCGAGTATTGGCTGATATGTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133195.1-622s1c1
Sequence:CCGGCCGGGCATATGAACGGATTAACTCGAGTTAATCCGTTCATATGCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133195.1-1149s1c1
Sequence:CCGGGCCGCCATCAACGCTCTACATCTCGAGATGTAGAGCGTTGATGGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133195.1-1781s1c1
Sequence:CCGGCGAGGGCTGTAACCTGCTCATCTCGAGATGAGCAGGTTACAGCCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133195.1-1705s1c1
Sequence:CCGGCTGCTGCCTATGGTCAGATTACTCGAGTAATCTGACCATAGGCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks