EMAIL THIS PAGE TO A FRIEND

CELF5

CUGBP, Elav-like family member 5

96 Gene Product Result for
Synonyms: BRUNOL-5 BRUNOL5 CELF-5
Gene ID:
Human(60680) Summary: This gene encodes a member of the the CELF/BRUNOL protein family, which contain two N-terminal RNA recognition motif (RRM) domains, one C-terminal RRM domain, and a divergent segment of 160-230 aa between the second and third RRM domains. Members of this protein family regulate pre-mRNA alternative splicing and may also be involved in mRNA editing and translation. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2012]
Mouse(319586) CUGBP, Elav-like family member 5
Rat(314647) CUGBP, Elav-like family member 5
domestic guinea pig(100718799) CUGBP, Elav-like family member 5
naked mole-rat(101718307) CUGBP, Elav-like family member 5
sheep(101118445) CUGBP, Elav-like family member 5
Zebrafish(568052) cugbp, Elav-like family member 5
cow(532293) CUGBP, Elav-like family member 5
domestic cat(101087304) CUGBP, Elav-like family member 5
dog(612072) CUGBP, Elav-like family member 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021938 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021938 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021938 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_176954 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_176954 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_176954 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021938 Rosetta Predictions human pricing
XM_001075513 Rosetta Predictions rat pricing
XM_234928 Rosetta Predictions rat pricing
NM_176954 Rosetta Predictions mouse pricing
XM_618789 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021938 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00048580 predicted 1287
2 SASI_Hs01_00048581 predicted 1298
3 SASI_Hs01_00048582 predicted 1326
4 SASI_Hs01_00048583 predicted 319
5 SASI_Hs01_00048584 predicted 1566
6 SASI_Hs01_00048585 predicted 336
7 SASI_Hs01_00048586 predicted 1364
8 SASI_Hs01_00048587 predicted 418
9 SASI_Hs01_00048588 predicted 1297
10 SASI_Hs01_00048589 predicted 1348
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075513 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00350023 predicted 452
2 SASI_Rn02_00350024 predicted 349
3 SASI_Rn02_00350025 predicted 280
4 SASI_Rn02_00350026 predicted 1068
5 SASI_Rn02_00350027 predicted 416
6 SASI_Rn02_00350028 predicted 535
7 SASI_Rn02_00350029 predicted 543
8 SASI_Rn02_00350030 predicted 888
9 SASI_Rn02_00350031 predicted 699
10 SASI_Rn02_00350032 predicted 896
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_234928 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00388788 predicted 1185
2 SASI_Rn02_00388789 predicted 1261
3 SASI_Rn02_00388790 predicted 1468
4 SASI_Rn02_00388791 predicted 1150
5 SASI_Rn02_00388792 predicted 1162
6 SASI_Rn02_00388793 predicted 1194
7 SASI_Rn02_00388794 predicted 1154
8 SASI_Rn02_00388795 predicted 1537
9 SASI_Rn02_00388796 predicted 1151
10 SASI_Rn02_00388797 predicted 1473
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176954 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00346840 predicted 1254
2 SASI_Mm02_00346841 predicted 1690
3 SASI_Mm02_00346842 predicted 1332
4 SASI_Mm02_00346843 predicted 1498
5 SASI_Mm02_00346844 predicted 1626
6 SASI_Mm02_00346845 predicted 925
7 SASI_Mm02_00346846 predicted 1216
8 SASI_Mm02_00346847 predicted 580
9 SASI_Mm02_00346848 predicted 1225
10 SASI_Mm02_00346849 predicted 487
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_618789 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00274238 predicted 358
2 SASI_Mm01_00274239 predicted 958
3 SASI_Mm01_00274240 predicted 888
4 SASI_Mm01_00274241 predicted 424
5 SASI_Mm01_00274242 predicted 1152
6 SASI_Mm01_00274243 predicted 544
7 SASI_Mm01_00274244 predicted 607
8 SASI_Mm01_00274245 predicted 593
9 SASI_Mm01_00274246 predicted 620
10 SASI_Mm01_00274247 predicted 269
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021938
VALIDATED
CELF5 MISSION shRNA Bacterial Glycerol Stock
CUGBP, Elav-like family member 5
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074428    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021938.2-1541s1c1
Sequence:CCGGCGTGATTTGTACAATGTACTTCTCGAGAAGTACATTGTACAAATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_021938.2-1366s1c1
Sequence:CCGGCGGCTTCGTGAGCTTTGATAACTCGAGTTATCAAAGCTCACGAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021938.2-1319s1c1
Sequence:CCGGTCCTCCAAGGTGTTTATGGATCTCGAGATCCATAAACACCTTGGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021938.2-320s1c1
Sequence:CCGGGCCAGGGATTCCGCCATCAAACTCGAGTTTGATGGCGGAATCCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021938.2-1306s1c1
Sequence:CCGGCGGCAATATCATTTCCTCCAACTCGAGTTGGAGGAAATGATATTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436666    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021938.3-1563s21c1
Sequence:CCGGATTTCTGCTACGAGTAATTTCCTCGAGGAAATTACTCGTAGCAGAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021938.3-400s21c1
Sequence:CCGGGAAGCCTGCGGACAGTGAAAGCTCGAGCTTTCACTGTCCGCAGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021938.3-1123s21c1
Sequence:CCGGAGTCCAGCAGTACACAGCCATCTCGAGATGGCTGTGTACTGCTGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021938.3-1266s21c1
Sequence:CCGGAGTTTGGAGACACGGAGCTGACTCGAGTCAGCTCCGTGTCTCCAAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021938.3-1342s21c1
Sequence:CCGGAGCTACCAACCAGAGCAAGTGCTCGAGCACTTGCTCTGGTTGGTAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418320    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021938.3-1718s21c1
Sequence:CCGGTGGTGTTCCTGTTACGTGTTTCTCGAGAAACACGTAACAGGAACACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021938.3-559s21c1
Sequence:CCGGAGGCTGTGCTTTCGTGAAGTTCTCGAGAACTTCACGAAAGCACAGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422174    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021938.3-1658s21c1
Sequence:CCGGACTTTGGGTTGACTCGGTTTGCTCGAGCAAACCGAGTCAACCCAAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021938.3-791s21c1
Sequence:CCGGATGCAACAGCAGACAACAGTCCTCGAGGACTGTTGTCTGCTGTTGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021938.3-160s21c1
Sequence:CCGGCCTGGACGCCATCAAACTCTTCTCGAGAAGAGTTTGATGGCGTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021938
VALIDATED
CELF5 MISSION shRNA shRNA Plasmid DNA
CUGBP, Elav-like family member 5
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074428    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021938.2-1541s1c1
Sequence:CCGGCGTGATTTGTACAATGTACTTCTCGAGAAGTACATTGTACAAATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_021938.2-1366s1c1
Sequence:CCGGCGGCTTCGTGAGCTTTGATAACTCGAGTTATCAAAGCTCACGAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021938.2-1319s1c1
Sequence:CCGGTCCTCCAAGGTGTTTATGGATCTCGAGATCCATAAACACCTTGGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021938.2-320s1c1
Sequence:CCGGGCCAGGGATTCCGCCATCAAACTCGAGTTTGATGGCGGAATCCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021938.2-1306s1c1
Sequence:CCGGCGGCAATATCATTTCCTCCAACTCGAGTTGGAGGAAATGATATTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436666    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021938.3-1563s21c1
Sequence:CCGGATTTCTGCTACGAGTAATTTCCTCGAGGAAATTACTCGTAGCAGAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021938.3-400s21c1
Sequence:CCGGGAAGCCTGCGGACAGTGAAAGCTCGAGCTTTCACTGTCCGCAGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021938.3-1123s21c1
Sequence:CCGGAGTCCAGCAGTACACAGCCATCTCGAGATGGCTGTGTACTGCTGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021938.3-1266s21c1
Sequence:CCGGAGTTTGGAGACACGGAGCTGACTCGAGTCAGCTCCGTGTCTCCAAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021938.3-1342s21c1
Sequence:CCGGAGCTACCAACCAGAGCAAGTGCTCGAGCACTTGCTCTGGTTGGTAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418320    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021938.3-1718s21c1
Sequence:CCGGTGGTGTTCCTGTTACGTGTTTCTCGAGAAACACGTAACAGGAACACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021938.3-559s21c1
Sequence:CCGGAGGCTGTGCTTTCGTGAAGTTCTCGAGAACTTCACGAAAGCACAGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422174    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021938.3-1658s21c1
Sequence:CCGGACTTTGGGTTGACTCGGTTTGCTCGAGCAAACCGAGTCAACCCAAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021938.3-791s21c1
Sequence:CCGGATGCAACAGCAGACAACAGTCCTCGAGGACTGTTGTCTGCTGTTGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021938.3-160s21c1
Sequence:CCGGCCTGGACGCCATCAAACTCTTCTCGAGAAGAGTTTGATGGCGTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021938
VALIDATED
CELF5 MISSION shRNA Lentiviral Transduction Particles
CUGBP, Elav-like family member 5
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074428    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021938.2-1541s1c1
Sequence:CCGGCGTGATTTGTACAATGTACTTCTCGAGAAGTACATTGTACAAATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_021938.2-1366s1c1
Sequence:CCGGCGGCTTCGTGAGCTTTGATAACTCGAGTTATCAAAGCTCACGAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021938.2-1319s1c1
Sequence:CCGGTCCTCCAAGGTGTTTATGGATCTCGAGATCCATAAACACCTTGGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021938.2-320s1c1
Sequence:CCGGGCCAGGGATTCCGCCATCAAACTCGAGTTTGATGGCGGAATCCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021938.2-1306s1c1
Sequence:CCGGCGGCAATATCATTTCCTCCAACTCGAGTTGGAGGAAATGATATTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436666    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021938.3-1563s21c1
Sequence:CCGGATTTCTGCTACGAGTAATTTCCTCGAGGAAATTACTCGTAGCAGAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021938.3-400s21c1
Sequence:CCGGGAAGCCTGCGGACAGTGAAAGCTCGAGCTTTCACTGTCCGCAGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021938.3-1123s21c1
Sequence:CCGGAGTCCAGCAGTACACAGCCATCTCGAGATGGCTGTGTACTGCTGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021938.3-1266s21c1
Sequence:CCGGAGTTTGGAGACACGGAGCTGACTCGAGTCAGCTCCGTGTCTCCAAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021938.3-1342s21c1
Sequence:CCGGAGCTACCAACCAGAGCAAGTGCTCGAGCACTTGCTCTGGTTGGTAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418320    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021938.3-1718s21c1
Sequence:CCGGTGGTGTTCCTGTTACGTGTTTCTCGAGAAACACGTAACAGGAACACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021938.3-559s21c1
Sequence:CCGGAGGCTGTGCTTTCGTGAAGTTCTCGAGAACTTCACGAAAGCACAGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422174    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021938.3-1658s21c1
Sequence:CCGGACTTTGGGTTGACTCGGTTTGCTCGAGCAAACCGAGTCAACCCAAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021938.3-791s21c1
Sequence:CCGGATGCAACAGCAGACAACAGTCCTCGAGGACTGTTGTCTGCTGTTGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021938.3-160s21c1
Sequence:CCGGCCTGGACGCCATCAAACTCTTCTCGAGAAGAGTTTGATGGCGTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176954
CELF5 MISSION shRNA Bacterial Glycerol Stock
CUGBP, Elav-like family member 5
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175301    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_176954.2-632s1c1
Sequence:CCGGCACCATACCTAAATCTGCATTCTCGAGAATGCAGATTTAGGTATGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173742    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_176954.2-703s1c1
Sequence:CCGGCTCAGTCTTGACGGTTGACTACTCGAGTAGTCAACCGTCAAGACTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193781    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_176954.2-594s1c1
Sequence:CCGGCAGAGTGCTAATGTCCCAATTCTCGAGAATTGGGACATTAGCACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176954.3-1081s21c1
Sequence:CCGGAGCAGTACACAGCCATGTATCCTCGAGGATACATGGCTGTGTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176954.3-1223s21c1
Sequence:CCGGTCATCTCCTCCAAGGTGTTTACTCGAGTAAACACCTTGGAGGAGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176954.3-619s21c1
Sequence:CCGGAGTTTGCCGACACGGATAAAGCTCGAGCTTTATCCGTGTCGGCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247426    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176954.3-4164s21c1
Sequence:CCGGCTACAATGAATTTCGTGAAATCTCGAGATTTCACGAAATTCATTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176954.3-827s21c1
Sequence:CCGGGATTGGTGCCGTCAGCCTTAACTCGAGTTAAGGCTGACGGCACCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176954
CELF5 MISSION shRNA shRNA Plasmid DNA
CUGBP, Elav-like family member 5
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175301    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_176954.2-632s1c1
Sequence:CCGGCACCATACCTAAATCTGCATTCTCGAGAATGCAGATTTAGGTATGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173742    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_176954.2-703s1c1
Sequence:CCGGCTCAGTCTTGACGGTTGACTACTCGAGTAGTCAACCGTCAAGACTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193781    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_176954.2-594s1c1
Sequence:CCGGCAGAGTGCTAATGTCCCAATTCTCGAGAATTGGGACATTAGCACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176954.3-1081s21c1
Sequence:CCGGAGCAGTACACAGCCATGTATCCTCGAGGATACATGGCTGTGTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176954.3-1223s21c1
Sequence:CCGGTCATCTCCTCCAAGGTGTTTACTCGAGTAAACACCTTGGAGGAGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176954.3-619s21c1
Sequence:CCGGAGTTTGCCGACACGGATAAAGCTCGAGCTTTATCCGTGTCGGCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247426    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176954.3-4164s21c1
Sequence:CCGGCTACAATGAATTTCGTGAAATCTCGAGATTTCACGAAATTCATTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176954.3-827s21c1
Sequence:CCGGGATTGGTGCCGTCAGCCTTAACTCGAGTTAAGGCTGACGGCACCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176954
CELF5 MISSION shRNA Lentiviral Transduction Particles
CUGBP, Elav-like family member 5
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175301    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_176954.2-632s1c1
Sequence:CCGGCACCATACCTAAATCTGCATTCTCGAGAATGCAGATTTAGGTATGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173742    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_176954.2-703s1c1
Sequence:CCGGCTCAGTCTTGACGGTTGACTACTCGAGTAGTCAACCGTCAAGACTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193781    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_176954.2-594s1c1
Sequence:CCGGCAGAGTGCTAATGTCCCAATTCTCGAGAATTGGGACATTAGCACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176954.3-1081s21c1
Sequence:CCGGAGCAGTACACAGCCATGTATCCTCGAGGATACATGGCTGTGTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176954.3-1223s21c1
Sequence:CCGGTCATCTCCTCCAAGGTGTTTACTCGAGTAAACACCTTGGAGGAGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176954.3-619s21c1
Sequence:CCGGAGTTTGCCGACACGGATAAAGCTCGAGCTTTATCCGTGTCGGCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247426    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176954.3-4164s21c1
Sequence:CCGGCTACAATGAATTTCGTGAAATCTCGAGATTTCACGAAATTCATTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176954.3-827s21c1
Sequence:CCGGGATTGGTGCCGTCAGCCTTAACTCGAGTTAAGGCTGACGGCACCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks