EMAIL THIS PAGE TO A FRIEND

CELF6

CUGBP, Elav-like family member 6

96 Gene Product Result for
Synonyms: BRUNOL6
UniProtKB ID: Q96J87, B4DG28, B4DJB6, Q6PII4, Q6ZNJ7, Q8N607
Gene ID:
Human(60677) Summary: Members of the CELF/BRUNOL protein family contain two N-terminal RNA recognition motif (RRM) domains, one C-terminal RRM domain, and a divergent segment of 160-230 aa between the second and third RRM domains. Members of this protein family regulate pre-mRNA alternative splicing and may also be involved in mRNA editing, and translation. Multiple alternatively spliced transcript variants encoding different isoforms have been identified in this gene. [provided by RefSeq, Feb 2010]
Mouse(76183) CUGBP, Elav-like family member 6
Rat(300758) CUGBP, Elav-like family member 6
cow(539205) CUGBP, Elav-like family member 6
domestic cat(101091875) CUGBP, Elav-like family member 6
dog(611308) CUGBP, Elav-like family member 6
sheep(101115798) CUGBP, Elav-like family member 6
naked mole-rat(101719174) CUGBP, Elav-like family member 6
domestic guinea pig(100715834) CUGBP, Elav-like family member 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_052840 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052840 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052840 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175235 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175235 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175235 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU007231 MISSION® esiRNA esiRNA targeting mouse Brunol6 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052840 Rosetta Predictions human pricing
NM_001106827 Rosetta Predictions rat pricing
NM_175235 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052840 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00205595 predicted 1519
2 SASI_Hs01_00205596 predicted 803
3 SASI_Hs01_00205597 predicted 1697
4 SASI_Hs01_00205598 predicted 1557
5 SASI_Hs01_00205599 predicted 822
6 SASI_Hs01_00205600 predicted 791
7 SASI_Hs01_00205601 predicted 1394
8 SASI_Hs02_00361520 predicted 1755
9 SASI_Hs01_00205603 predicted 831
10 SASI_Hs01_00205604 predicted 1387
11 SASI_Hs01_00205602 predicted 1606
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106827 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00222798 predicted 1361
2 SASI_Rn02_00222799 predicted 1294
3 SASI_Rn02_00222800 predicted 590
4 SASI_Rn02_00222801 predicted 521
5 SASI_Rn02_00222802 predicted 1025
6 SASI_Rn02_00222803 predicted 1340
7 SASI_Rn02_00222804 predicted 1353
8 SASI_Rn02_00222805 predicted 576
9 SASI_Rn02_00222806 predicted 649
10 SASI_Rn02_00222807 predicted 878
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175235 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00172162 predicted 569
2 SASI_Mm01_00172163 predicted 1339
3 SASI_Mm01_00172164 predicted 1195
4 SASI_Mm01_00172165 predicted 1069
5 SASI_Mm01_00172166 predicted 631
6 SASI_Mm01_00172167 predicted 1382
7 SASI_Mm01_00172169 predicted 612
8 SASI_Mm01_00172170 predicted 1398
9 SASI_Mm01_00172171 predicted 380
10 SASI_Mm02_00345920 predicted 1413
11 SASI_Mm01_00172168 predicted 1237
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052840
CELF6 MISSION shRNA Bacterial Glycerol Stock
CUGBP, Elav-like family member 6
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052840.4-812s21c1
Sequence:CCGGAGTCCTGACGGCACCAGTAAACTCGAGTTTACTGGTGCCGTCAGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412680    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052840.4-2197s21c1
Sequence:CCGGAGACAGTATAGAGTCTCATAACTCGAGTTATGAGACTCTATACTGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427843    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052840.4-2077s21c1
Sequence:CCGGCATATCATTCCTTAGAGTTTACTCGAGTAAACTCTAAGGAATGATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052840.2-1363s1c1
Sequence:CCGGCCAGACTGCTATTCAGGCGATCTCGAGATCGCCTGAATAGCAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052840.2-1283s1c1
Sequence:CCGGTCTGCTAAAGTCTTTGTGGATCTCGAGATCCACAAAGACTTTAGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052840.2-91s1c1
Sequence:CCGGCGTCGGCATGAGCGGGCTAAACTCGAGTTTAGCCCGCTCATGCCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052840.2-1249s1c1
Sequence:CCGGCATACAGACATTCCTGCCCTTCTCGAGAAGGGCAGGAATGTCTGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074448    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052840.2-1756s1c1
Sequence:CCGGGCCCAGATTTACTTCTTTCAACTCGAGTTGAAAGAAGTAAATCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052840
CELF6 MISSION shRNA shRNA Plasmid DNA
CUGBP, Elav-like family member 6
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052840.4-812s21c1
Sequence:CCGGAGTCCTGACGGCACCAGTAAACTCGAGTTTACTGGTGCCGTCAGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412680    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052840.4-2197s21c1
Sequence:CCGGAGACAGTATAGAGTCTCATAACTCGAGTTATGAGACTCTATACTGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427843    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052840.4-2077s21c1
Sequence:CCGGCATATCATTCCTTAGAGTTTACTCGAGTAAACTCTAAGGAATGATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052840.2-1363s1c1
Sequence:CCGGCCAGACTGCTATTCAGGCGATCTCGAGATCGCCTGAATAGCAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052840.2-1283s1c1
Sequence:CCGGTCTGCTAAAGTCTTTGTGGATCTCGAGATCCACAAAGACTTTAGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052840.2-91s1c1
Sequence:CCGGCGTCGGCATGAGCGGGCTAAACTCGAGTTTAGCCCGCTCATGCCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052840.2-1249s1c1
Sequence:CCGGCATACAGACATTCCTGCCCTTCTCGAGAAGGGCAGGAATGTCTGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074448    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052840.2-1756s1c1
Sequence:CCGGGCCCAGATTTACTTCTTTCAACTCGAGTTGAAAGAAGTAAATCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052840
CELF6 MISSION shRNA Lentiviral Transduction Particles
CUGBP, Elav-like family member 6
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052840.4-812s21c1
Sequence:CCGGAGTCCTGACGGCACCAGTAAACTCGAGTTTACTGGTGCCGTCAGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412680    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052840.4-2197s21c1
Sequence:CCGGAGACAGTATAGAGTCTCATAACTCGAGTTATGAGACTCTATACTGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427843    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052840.4-2077s21c1
Sequence:CCGGCATATCATTCCTTAGAGTTTACTCGAGTAAACTCTAAGGAATGATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052840.2-1363s1c1
Sequence:CCGGCCAGACTGCTATTCAGGCGATCTCGAGATCGCCTGAATAGCAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052840.2-1283s1c1
Sequence:CCGGTCTGCTAAAGTCTTTGTGGATCTCGAGATCCACAAAGACTTTAGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052840.2-91s1c1
Sequence:CCGGCGTCGGCATGAGCGGGCTAAACTCGAGTTTAGCCCGCTCATGCCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052840.2-1249s1c1
Sequence:CCGGCATACAGACATTCCTGCCCTTCTCGAGAAGGGCAGGAATGTCTGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074448    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052840.2-1756s1c1
Sequence:CCGGGCCCAGATTTACTTCTTTCAACTCGAGTTGAAAGAAGTAAATCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175235
CELF6 MISSION shRNA Bacterial Glycerol Stock
CUGBP, Elav-like family member 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098640    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175235.3-1968s1c1
Sequence:CCGGCCACCCTTTAAGAATATGATACTCGAGTATCATATTCTTAAAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175235.3-1122s1c1
Sequence:CCGGCCTTCAGCTCTGCCTCAACAACTCGAGTTGTTGAGGCAGAGCTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175235.3-380s1c1
Sequence:CCGGGCCAGGGATGAATCGTCCGATCTCGAGATCGGACGATTCATCCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175235.3-570s1c1
Sequence:CCGGGCCTTTGTGAAATTCGGAAGTCTCGAGACTTCCGAATTTCACAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175235.3-983s1c1
Sequence:CCGGAGTCAATGGATTCGGCTCCTTCTCGAGAAGGAGCCGAATCCATTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175235
CELF6 MISSION shRNA shRNA Plasmid DNA
CUGBP, Elav-like family member 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098640    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175235.3-1968s1c1
Sequence:CCGGCCACCCTTTAAGAATATGATACTCGAGTATCATATTCTTAAAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175235.3-1122s1c1
Sequence:CCGGCCTTCAGCTCTGCCTCAACAACTCGAGTTGTTGAGGCAGAGCTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175235.3-380s1c1
Sequence:CCGGGCCAGGGATGAATCGTCCGATCTCGAGATCGGACGATTCATCCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175235.3-570s1c1
Sequence:CCGGGCCTTTGTGAAATTCGGAAGTCTCGAGACTTCCGAATTTCACAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175235.3-983s1c1
Sequence:CCGGAGTCAATGGATTCGGCTCCTTCTCGAGAAGGAGCCGAATCCATTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175235
CELF6 MISSION shRNA Lentiviral Transduction Particles
CUGBP, Elav-like family member 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098640    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175235.3-1968s1c1
Sequence:CCGGCCACCCTTTAAGAATATGATACTCGAGTATCATATTCTTAAAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175235.3-1122s1c1
Sequence:CCGGCCTTCAGCTCTGCCTCAACAACTCGAGTTGTTGAGGCAGAGCTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175235.3-380s1c1
Sequence:CCGGGCCAGGGATGAATCGTCCGATCTCGAGATCGGACGATTCATCCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175235.3-570s1c1
Sequence:CCGGGCCTTTGTGAAATTCGGAAGTCTCGAGACTTCCGAATTTCACAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175235.3-983s1c1
Sequence:CCGGAGTCAATGGATTCGGCTCCTTCTCGAGAAGGAGCCGAATCCATTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks