EMAIL THIS PAGE TO A FRIEND

CELSR3

cadherin, EGF LAG seven-pass G-type receptor 3

178 Gene Product Result for
Synonyms: CDHF11 EGFL1 FMI1 HFMI1 MEGF2 RESDA1
UniProtKB ID: Q9NYQ7, O75092
Gene ID:
Human(1951) Summary: This gene belongs to the flamingo subfamily, which is included in the cadherin superfamily. The flamingo cadherins consist of nonclassic-type cadherins that do not interact with catenins. They are plasma membrane proteins containing seven epidermal growth factor-like repeats, nine cadherin domains and two laminin A G-type repeats in their ectodomain. They also have seven transmembrane domains, a characteristic feature of their subfamily. The encoded protein may be involved in the regulation of contact-dependent neurite growth and may play a role in tumor formation. [provided by RefSeq, Jun 2013]
Mouse(107934) cadherin, EGF LAG seven-pass G-type receptor 3 (flamingo homolog, Drosophila)
Rat(83466) cadherin, EGF LAG seven-pass G-type receptor 3
domestic guinea pig(100727255) cadherin, EGF LAG seven-pass G-type receptor 3
naked mole-rat(101720569) cadherin, EGF LAG seven-pass G-type receptor 3
sheep(101118998) cadherin, EGF LAG seven-pass G-type receptor 3 (flamingo homolog, Drosophila)
Zebrafish(100008568) cadherin, EGF LAG seven-pass G-type receptor 3
cow(523793) cadherin, EGF LAG seven-pass G-type receptor 3 (flamingo homolog, Drosophila)
domestic cat(101089751) cadherin, EGF LAG seven-pass G-type receptor 3 (flamingo homolog, Drosophila)
dog(476635) cadherin, EGF LAG seven-pass G-type receptor 3 (flamingo homolog, Drosophila)
chicken(416011) cadherin, EGF LAG seven-pass G-type receptor 3 (flamingo homolog, Drosophila)
Gene Class: Cell_Adhesion
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080437 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_080437 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_080437 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001407 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001407 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001407 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU013641 MISSION® esiRNA esiRNA targeting mouse Celsr3 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001407 Rosetta Predictions human pricing
NM_031320 Rosetta Predictions rat pricing
NM_080437 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001407 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00158405 predicted 3365
2 SASI_Hs02_00331789 predicted 2247
3 SASI_Hs01_00158407 predicted 7194
4 SASI_Hs01_00158408 predicted 2528
5 SASI_Hs01_00158409 predicted 2318
6 SASI_Hs01_00158411 predicted 7492
7 SASI_Hs01_00158413 predicted 2324
8 SASI_Hs02_00331790 predicted 6394
9 SASI_Hs02_00331791 predicted 3576
10 SASI_Hs02_00331792 predicted 9412
11 SASI_Hs01_00158404 predicted 3074
12 SASI_Hs01_00158406 predicted 2754
13 SASI_Hs01_00158410 predicted 2834
14 SASI_Hs01_00158412 predicted 2861
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031320 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00070350 predicted 2293
2 SASI_Rn01_00070351 predicted 10162
3 SASI_Rn01_00070352 predicted 7043
4 SASI_Rn01_00070353 predicted 3034
5 SASI_Rn01_00070354 predicted 1769
6 SASI_Rn01_00070355 predicted 3951
7 SASI_Rn01_00070356 predicted 9863
8 SASI_Rn01_00070357 predicted 3086
9 SASI_Rn01_00070358 predicted 9408
10 SASI_Rn01_00070359 predicted 3679
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080437 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00062196 predicted 2015
2 SASI_Mm01_00062197 predicted 8035
3 SASI_Mm02_00338093 predicted 6721
4 SASI_Mm01_00062199 predicted 7619
5 SASI_Mm01_00062200 predicted 1699
6 SASI_Mm01_00062201 predicted 1491
7 SASI_Mm01_00062202 predicted 9218
8 SASI_Mm01_00062203 predicted 1809
9 SASI_Mm02_00338094 predicted 9553
10 SASI_Mm01_00062204 predicted 5372
11 SASI_Mm01_00062195 predicted 9112
12 SASI_Mm01_00062198 predicted 3509
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080437
CELSR3 MISSION shRNA Bacterial Glycerol Stock
cadherin, EGF LAG seven-pass G-type receptor 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094949    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080437.1-11065s1c1
Sequence:CCGGCCTCTTTGTTTACAAGTGAAACTCGAGTTTCACTTGTAAACAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080437.1-3271s1c1
Sequence:CCGGGCTCATATAATGTACCAGATTCTCGAGAATCTGGTACATTATATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080437.1-3270s1c1
Sequence:CCGGCGCTCATATAATGTACCAGATCTCGAGATCTGGTACATTATATGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080437.1-6931s1c1
Sequence:CCGGCCCAATATCATGCTCAGCATTCTCGAGAATGCTGAGCATGATATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080437.1-1699s1c1
Sequence:CCGGGCCAATGGTTTGGTGCATTATCTCGAGATAATGCACCAAACCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080437
CELSR3 MISSION shRNA shRNA Plasmid DNA
cadherin, EGF LAG seven-pass G-type receptor 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094949    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080437.1-11065s1c1
Sequence:CCGGCCTCTTTGTTTACAAGTGAAACTCGAGTTTCACTTGTAAACAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080437.1-3271s1c1
Sequence:CCGGGCTCATATAATGTACCAGATTCTCGAGAATCTGGTACATTATATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080437.1-3270s1c1
Sequence:CCGGCGCTCATATAATGTACCAGATCTCGAGATCTGGTACATTATATGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080437.1-6931s1c1
Sequence:CCGGCCCAATATCATGCTCAGCATTCTCGAGAATGCTGAGCATGATATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080437.1-1699s1c1
Sequence:CCGGGCCAATGGTTTGGTGCATTATCTCGAGATAATGCACCAAACCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080437
CELSR3 MISSION shRNA Lentiviral Transduction Particles
cadherin, EGF LAG seven-pass G-type receptor 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094949    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080437.1-11065s1c1
Sequence:CCGGCCTCTTTGTTTACAAGTGAAACTCGAGTTTCACTTGTAAACAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080437.1-3271s1c1
Sequence:CCGGGCTCATATAATGTACCAGATTCTCGAGAATCTGGTACATTATATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080437.1-3270s1c1
Sequence:CCGGCGCTCATATAATGTACCAGATCTCGAGATCTGGTACATTATATGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080437.1-6931s1c1
Sequence:CCGGCCCAATATCATGCTCAGCATTCTCGAGAATGCTGAGCATGATATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080437.1-1699s1c1
Sequence:CCGGGCCAATGGTTTGGTGCATTATCTCGAGATAATGCACCAAACCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001407
CELSR3 MISSION shRNA Bacterial Glycerol Stock
cadherin, EGF LAG seven-pass G-type receptor 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011244    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001407.1-11061s1c1
Sequence:CCGGCCTGCTTGAATTGATTCCGAACTCGAGTTCGGAATCAATTCAAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001407.1-2754s1c1
Sequence:CCGGCGCTACTTCAAGCTGGTACTACTCGAGTAGTACCAGCTTGAAGTAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001407.1-7245s1c1
Sequence:CCGGCCTAATATCATGCTCAGCATTCTCGAGAATGCTGAGCATGATATTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001407.1-7498s1c1
Sequence:CCGGCCATTATCATTCTCCTCGTTTCTCGAGAAACGAGGAGAATGATAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001407.1-3657s1c1
Sequence:CCGGGCACTCATTGACCTAGACTATCTCGAGATAGTCTAGGTCAATGAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001407.2-2756s21c1
Sequence:CCGGCTACTTCAAGCTGGTACTAACCTCGAGGTTAGTACCAGCTTGAAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001407.2-3972s21c1
Sequence:CCGGAGCCGAAAGCTAGACAATAACCTCGAGGTTATTGTCTAGCTTTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001407.2-7500s21c1
Sequence:CCGGATTATCATTCTCCTCGTTTACCTCGAGGTAAACGAGGAGAATGATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001407.2-6929s21c1
Sequence:CCGGTGGCCACACTGACCACTATTTCTCGAGAAATAGTGGTCAGTGTGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001407
CELSR3 MISSION shRNA shRNA Plasmid DNA
cadherin, EGF LAG seven-pass G-type receptor 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011244    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001407.1-11061s1c1
Sequence:CCGGCCTGCTTGAATTGATTCCGAACTCGAGTTCGGAATCAATTCAAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001407.1-2754s1c1
Sequence:CCGGCGCTACTTCAAGCTGGTACTACTCGAGTAGTACCAGCTTGAAGTAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001407.1-7245s1c1
Sequence:CCGGCCTAATATCATGCTCAGCATTCTCGAGAATGCTGAGCATGATATTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001407.1-7498s1c1
Sequence:CCGGCCATTATCATTCTCCTCGTTTCTCGAGAAACGAGGAGAATGATAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001407.1-3657s1c1
Sequence:CCGGGCACTCATTGACCTAGACTATCTCGAGATAGTCTAGGTCAATGAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001407.2-2756s21c1
Sequence:CCGGCTACTTCAAGCTGGTACTAACCTCGAGGTTAGTACCAGCTTGAAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001407.2-3972s21c1
Sequence:CCGGAGCCGAAAGCTAGACAATAACCTCGAGGTTATTGTCTAGCTTTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001407.2-7500s21c1
Sequence:CCGGATTATCATTCTCCTCGTTTACCTCGAGGTAAACGAGGAGAATGATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001407.2-6929s21c1
Sequence:CCGGTGGCCACACTGACCACTATTTCTCGAGAAATAGTGGTCAGTGTGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001407
CELSR3 MISSION shRNA Lentiviral Transduction Particles
cadherin, EGF LAG seven-pass G-type receptor 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011244    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001407.1-11061s1c1
Sequence:CCGGCCTGCTTGAATTGATTCCGAACTCGAGTTCGGAATCAATTCAAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001407.1-2754s1c1
Sequence:CCGGCGCTACTTCAAGCTGGTACTACTCGAGTAGTACCAGCTTGAAGTAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001407.1-7245s1c1
Sequence:CCGGCCTAATATCATGCTCAGCATTCTCGAGAATGCTGAGCATGATATTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001407.1-7498s1c1
Sequence:CCGGCCATTATCATTCTCCTCGTTTCTCGAGAAACGAGGAGAATGATAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001407.1-3657s1c1
Sequence:CCGGGCACTCATTGACCTAGACTATCTCGAGATAGTCTAGGTCAATGAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001407.2-2756s21c1
Sequence:CCGGCTACTTCAAGCTGGTACTAACCTCGAGGTTAGTACCAGCTTGAAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001407.2-3972s21c1
Sequence:CCGGAGCCGAAAGCTAGACAATAACCTCGAGGTTATTGTCTAGCTTTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001407.2-7500s21c1
Sequence:CCGGATTATCATTCTCCTCGTTTACCTCGAGGTAAACGAGGAGAATGATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001407.2-6929s21c1
Sequence:CCGGTGGCCACACTGACCACTATTTCTCGAGAAATAGTGGTCAGTGTGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks