EMAIL THIS PAGE TO A FRIEND

CEMP1

cementum protein 1

19 Gene Product Result for
Synonyms: CP-23 CP23
Species: Human CEMP1(752014)
UniProtKB ID: Q6PRD7, B2RUY1
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001048212 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001048212 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001048212 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU103401 MISSION® esiRNA esiRNA human CEMP1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001048212 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001048212 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311712 predicted 1101
2 SASI_Hs02_00311713 predicted 567
3 SASI_Hs02_00311714 predicted 989
4 SASI_Hs02_00311715 predicted 730
5 SASI_Hs02_00311716 predicted 570
6 SASI_Hs02_00311717 predicted 747
7 SASI_Hs02_00311718 predicted 361
8 SASI_Hs02_00311719 predicted 616
9 SASI_Hs02_00311720 predicted 945
10 SASI_Hs02_00311721 predicted 1071
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001048212
CEMP1 MISSION shRNA Bacterial Glycerol Stock
cementum protein 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048212.2-891s21c1
Sequence:CCGGGGAGAGAAAGTCAAGACAATCCTCGAGGATTGTCTTGACTTTCTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048212.2-397s21c1
Sequence:CCGGGGCGATGCTCAACCTCTAACACTCGAGTGTTAGAGGTTGAGCATCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256321    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001048212.2-1183s21c1
Sequence:CCGGTGTGAAGAGATAGGGTTATTGCTCGAGCAATAACCCTATCTCTTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048212.2-1073s21c1
Sequence:CCGGAGATGGCAGGATGACACTAATCTCGAGATTAGTGTCATCCTGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048212.2-734s21c1
Sequence:CCGGCCAGACCATCCTATCTCTTTGCTCGAGCAAAGAGATAGGATGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001048212
CEMP1 MISSION shRNA shRNA Plasmid DNA
cementum protein 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048212.2-891s21c1
Sequence:CCGGGGAGAGAAAGTCAAGACAATCCTCGAGGATTGTCTTGACTTTCTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048212.2-397s21c1
Sequence:CCGGGGCGATGCTCAACCTCTAACACTCGAGTGTTAGAGGTTGAGCATCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256321    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001048212.2-1183s21c1
Sequence:CCGGTGTGAAGAGATAGGGTTATTGCTCGAGCAATAACCCTATCTCTTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048212.2-1073s21c1
Sequence:CCGGAGATGGCAGGATGACACTAATCTCGAGATTAGTGTCATCCTGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048212.2-734s21c1
Sequence:CCGGCCAGACCATCCTATCTCTTTGCTCGAGCAAAGAGATAGGATGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001048212
CEMP1 MISSION shRNA Lentiviral Transduction Particles
cementum protein 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048212.2-891s21c1
Sequence:CCGGGGAGAGAAAGTCAAGACAATCCTCGAGGATTGTCTTGACTTTCTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048212.2-397s21c1
Sequence:CCGGGGCGATGCTCAACCTCTAACACTCGAGTGTTAGAGGTTGAGCATCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256321    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001048212.2-1183s21c1
Sequence:CCGGTGTGAAGAGATAGGGTTATTGCTCGAGCAATAACCCTATCTCTTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048212.2-1073s21c1
Sequence:CCGGAGATGGCAGGATGACACTAATCTCGAGATTAGTGTCATCCTGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048212.2-734s21c1
Sequence:CCGGCCAGACCATCCTATCTCTTTGCTCGAGCAAAGAGATAGGATGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks