EMAIL THIS PAGE TO A FRIEND

CEND1

cell cycle exit and neuronal differentiation 1

59 Gene Product Result for
Synonyms: BM88
UniProtKB ID: Q8N111, Q9NYM6
Gene ID:
Human(51286) Summary: The protein encoded by this gene is a neuron-specific protein. The similar protein in pig enhances neuroblastoma cell differentiation in vitro and may be involved in neuronal differentiation in vivo. Multiple pseudogenes have been reported for this gene. [provided by RefSeq, Jul 2008]
Mouse(57754) cell cycle exit and neuronal differentiation 1
Rat(361675) cell cycle exit and neuronal differentiation 1
chicken(770044) cell cycle exit and neuronal differentiation 1
domestic cat(101099247) cell cycle exit and neuronal differentiation 1
cow(504370) cell cycle exit and neuronal differentiation 1
naked mole-rat(101705042) cell cycle exit and neuronal differentiation 1
domestic guinea pig(100717503) cell cycle exit and neuronal differentiation 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021316 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021316 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021316 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016564 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016564 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016564 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016564 Rosetta Predictions human pricing
NM_001014163 Rosetta Predictions rat pricing
XM_341959 Rosetta Predictions rat pricing
NM_021316 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016564 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00119992 predicted 690
2 SASI_Hs01_00119993 predicted 689
3 SASI_Hs01_00119995 predicted 682
4 SASI_Hs01_00120000 predicted 676
5 SASI_Hs01_00120001 predicted 576
6 SASI_Hs01_00119999 predicted 1046
7 SASI_Hs01_00119994 predicted 710
8 SASI_Hs02_00349694 predicted 1358
9 SASI_Hs02_00349695 predicted 1592
10 SASI_Hs02_00349696 predicted 1361
11 SASI_Hs01_00119996 predicted 1119
12 SASI_Hs01_00119997 predicted 702
13 SASI_Hs01_00119998 predicted 1086
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014163 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00114589 predicted 1027
2 SASI_Rn01_00114590 predicted 413
3 SASI_Rn01_00114591 predicted 1120
4 SASI_Rn01_00114592 predicted 402
5 SASI_Rn01_00114593 predicted 1125
6 SASI_Rn01_00114594 predicted 475
7 SASI_Rn02_00201652 predicted 674
8 SASI_Rn01_00114596 predicted 519
9 SASI_Rn01_00114597 predicted 610
10 SASI_Rn01_00114598 predicted 694
11 SASI_Rn01_00114595 predicted 473
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341959 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00156000 predicted 401
2 SASI_Rn01_00156001 predicted 501
3 SASI_Rn01_00156002 predicted 392
4 SASI_Rn01_00156003 predicted 462
5 SASI_Rn01_00156004 predicted 300
6 SASI_Rn01_00156005 predicted 463
7 SASI_Rn01_00156006 predicted 199
8 SASI_Rn01_00156007 predicted 395
9 SASI_Rn01_00156008 predicted 394
10 SASI_Rn01_00156009 predicted 233
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021316 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00184926 predicted 468
2 SASI_Mm01_00184927 predicted 391
3 SASI_Mm01_00184928 predicted 305
4 SASI_Mm01_00184929 predicted 1042
5 SASI_Mm01_00184930 predicted 1001
6 SASI_Mm01_00184931 predicted 466
7 SASI_Mm01_00184932 predicted 1069
8 SASI_Mm01_00184933 predicted 1103
9 SASI_Mm01_00184934 predicted 314
10 SASI_Mm01_00184935 predicted 228
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021316
CEND1 MISSION shRNA Bacterial Glycerol Stock
cell cycle exit and neuronal differentiation 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021316.3-394s21c1
Sequence:CCGGAGCCAAGGCAGATCCTGTACTCTCGAGAGTACAGGATCTGCCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021316.3-304s21c1
Sequence:CCGGTCCCTTGACCAAGCCTGTGAACTCGAGTTCACAGGCTTGGTCAAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021316.3-598s21c1
Sequence:CCGGCGTGGCCACCATAGCTCTAATCTCGAGATTAGAGCTATGGTGGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021316.3-549s21c1
Sequence:CCGGCCTGGCCTTGTGAGAACTTGACTCGAGTCAAGTTCTCACAAGGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238225    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021316.3-1395s21c1
Sequence:CCGGTTGAGTTTAACAGCGTATAAACTCGAGTTTATACGCTGTTAAACTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193287    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021316.2-1394s1c1
Sequence:CCGGCCTTGAGTTTAACAGCGTATACTCGAGTATACGCTGTTAAACTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174481    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021316.2-608s1c1
Sequence:CCGGCATAGCTCTAATTCTTGGTGTCTCGAGACACCAAGAATTAGAGCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021316
CEND1 MISSION shRNA shRNA Plasmid DNA
cell cycle exit and neuronal differentiation 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021316.3-394s21c1
Sequence:CCGGAGCCAAGGCAGATCCTGTACTCTCGAGAGTACAGGATCTGCCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021316.3-304s21c1
Sequence:CCGGTCCCTTGACCAAGCCTGTGAACTCGAGTTCACAGGCTTGGTCAAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021316.3-598s21c1
Sequence:CCGGCGTGGCCACCATAGCTCTAATCTCGAGATTAGAGCTATGGTGGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021316.3-549s21c1
Sequence:CCGGCCTGGCCTTGTGAGAACTTGACTCGAGTCAAGTTCTCACAAGGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238225    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021316.3-1395s21c1
Sequence:CCGGTTGAGTTTAACAGCGTATAAACTCGAGTTTATACGCTGTTAAACTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193287    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021316.2-1394s1c1
Sequence:CCGGCCTTGAGTTTAACAGCGTATACTCGAGTATACGCTGTTAAACTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174481    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021316.2-608s1c1
Sequence:CCGGCATAGCTCTAATTCTTGGTGTCTCGAGACACCAAGAATTAGAGCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021316
CEND1 MISSION shRNA Lentiviral Transduction Particles
cell cycle exit and neuronal differentiation 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021316.3-394s21c1
Sequence:CCGGAGCCAAGGCAGATCCTGTACTCTCGAGAGTACAGGATCTGCCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021316.3-304s21c1
Sequence:CCGGTCCCTTGACCAAGCCTGTGAACTCGAGTTCACAGGCTTGGTCAAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021316.3-598s21c1
Sequence:CCGGCGTGGCCACCATAGCTCTAATCTCGAGATTAGAGCTATGGTGGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021316.3-549s21c1
Sequence:CCGGCCTGGCCTTGTGAGAACTTGACTCGAGTCAAGTTCTCACAAGGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238225    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021316.3-1395s21c1
Sequence:CCGGTTGAGTTTAACAGCGTATAAACTCGAGTTTATACGCTGTTAAACTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193287    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021316.2-1394s1c1
Sequence:CCGGCCTTGAGTTTAACAGCGTATACTCGAGTATACGCTGTTAAACTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174481    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021316.2-608s1c1
Sequence:CCGGCATAGCTCTAATTCTTGGTGTCTCGAGACACCAAGAATTAGAGCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016564
CEND1 MISSION shRNA Bacterial Glycerol Stock
cell cycle exit and neuronal differentiation 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000219967    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016564.3-526s1c1
Sequence:CCGGCCTGGTCCTGTGAGAACTTCACTCGAGTGAAGTTCTCACAGGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219966    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016564.3-284s1c1
Sequence:CCGGCTTGACCAAGCCCTCGAAGAACTCGAGTTCTTCGAGGGCTTGGTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155893    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016564.2-386s1c1
Sequence:CCGGCCTTCTCAACAACCACAGCAACTCGAGTTGCTGTGGTTGTTGAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153604    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016564.2-721s1c1
Sequence:CCGGCGCACATTCATTACACACCTACTCGAGTAGGTGTGTAATGAATGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152529    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016564.2-696s1c1
Sequence:CCGGGTTCACCCTTACCTATTCGTACTCGAGTACGAATAGGTAAGGGTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152410    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016564.2-1385s1c1
Sequence:CCGGCAGGTAGAGTAGAACTGCTTTCTCGAGAAAGCAGTTCTACTCTACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151382    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016564.2-1369s1c1
Sequence:CCGGGCGTATAATGCAATAACAGGTCTCGAGACCTGTTATTGCATTATACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152244    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016564.2-1366s1c1
Sequence:CCGGCCAGCGTATAATGCAATAACACTCGAGTGTTATTGCATTATACGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154253    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016564.2-1356s1c1
Sequence:CCGGCTGAGTCTAACCAGCGTATAACTCGAGTTATACGCTGGTTAGACTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155848    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016564.2-707s1c1
Sequence:CCGGCCTATTCGTACACACGCACATCTCGAGATGTGCGTGTGTACGAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016564
CEND1 MISSION shRNA shRNA Plasmid DNA
cell cycle exit and neuronal differentiation 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000219967    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016564.3-526s1c1
Sequence:CCGGCCTGGTCCTGTGAGAACTTCACTCGAGTGAAGTTCTCACAGGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219966    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016564.3-284s1c1
Sequence:CCGGCTTGACCAAGCCCTCGAAGAACTCGAGTTCTTCGAGGGCTTGGTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155893    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016564.2-386s1c1
Sequence:CCGGCCTTCTCAACAACCACAGCAACTCGAGTTGCTGTGGTTGTTGAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153604    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016564.2-721s1c1
Sequence:CCGGCGCACATTCATTACACACCTACTCGAGTAGGTGTGTAATGAATGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152529    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016564.2-696s1c1
Sequence:CCGGGTTCACCCTTACCTATTCGTACTCGAGTACGAATAGGTAAGGGTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152410    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016564.2-1385s1c1
Sequence:CCGGCAGGTAGAGTAGAACTGCTTTCTCGAGAAAGCAGTTCTACTCTACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151382    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016564.2-1369s1c1
Sequence:CCGGGCGTATAATGCAATAACAGGTCTCGAGACCTGTTATTGCATTATACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152244    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016564.2-1366s1c1
Sequence:CCGGCCAGCGTATAATGCAATAACACTCGAGTGTTATTGCATTATACGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154253    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016564.2-1356s1c1
Sequence:CCGGCTGAGTCTAACCAGCGTATAACTCGAGTTATACGCTGGTTAGACTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155848    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016564.2-707s1c1
Sequence:CCGGCCTATTCGTACACACGCACATCTCGAGATGTGCGTGTGTACGAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016564
CEND1 MISSION shRNA Lentiviral Transduction Particles
cell cycle exit and neuronal differentiation 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000219967    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016564.3-526s1c1
Sequence:CCGGCCTGGTCCTGTGAGAACTTCACTCGAGTGAAGTTCTCACAGGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219966    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016564.3-284s1c1
Sequence:CCGGCTTGACCAAGCCCTCGAAGAACTCGAGTTCTTCGAGGGCTTGGTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155893    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016564.2-386s1c1
Sequence:CCGGCCTTCTCAACAACCACAGCAACTCGAGTTGCTGTGGTTGTTGAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153604    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016564.2-721s1c1
Sequence:CCGGCGCACATTCATTACACACCTACTCGAGTAGGTGTGTAATGAATGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152529    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016564.2-696s1c1
Sequence:CCGGGTTCACCCTTACCTATTCGTACTCGAGTACGAATAGGTAAGGGTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152410    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016564.2-1385s1c1
Sequence:CCGGCAGGTAGAGTAGAACTGCTTTCTCGAGAAAGCAGTTCTACTCTACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151382    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016564.2-1369s1c1
Sequence:CCGGGCGTATAATGCAATAACAGGTCTCGAGACCTGTTATTGCATTATACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152244    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016564.2-1366s1c1
Sequence:CCGGCCAGCGTATAATGCAATAACACTCGAGTGTTATTGCATTATACGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154253    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016564.2-1356s1c1
Sequence:CCGGCTGAGTCTAACCAGCGTATAACTCGAGTTATACGCTGGTTAGACTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155848    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016564.2-707s1c1
Sequence:CCGGCCTATTCGTACACACGCACATCTCGAGATGTGCGTGTGTACGAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks