EMAIL THIS PAGE TO A FRIEND

CENPA

centromere protein A

79 Gene Product Result for
Synonyms: CENP-A CenH3
UniProtKB ID: P49450, D6W544, Q53T74, Q9BVW2
Gene ID:
Human(1058) Summary: Centromeres are the differentiated chromosomal domains that specify the mitotic behavior of chromosomes. CENPA encodes a centromere protein which contains a histone H3 related histone fold domain that is required for targeting to the centromere. CENPA is proposed to be a component of a modified nucleosome or nucleosome-like structure in which it replaces 1 or both copies of conventional histone H3 in the (H3-H4)2 tetrameric core of the nucleosome particle. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Mouse(12615) centromere protein A
Rat(298850) centromere protein A
Zebrafish(100302659) histone H3-like centromeric protein A
chicken(100113359) centromere protein A
domestic cat(101082304) centromere protein A
cow(613898) centromere protein A
dog(475692) centromere protein A
sheep(101110750) centromere protein A
domestic guinea pig(100724949) centromere protein A
naked mole-rat(101700835) centromere protein A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001809 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001809 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001809 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007681 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007681 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007681 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042426 Rosetta Predictions human pricing
NM_001809 Rosetta Predictions human pricing
NM_001106711 Rosetta Predictions rat pricing
NM_007681 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042426 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00309698 predicted 999
2 SASI_Hs02_00309699 predicted 1016
3 SASI_Hs02_00309700 predicted 971
4 SASI_Hs02_00309701 predicted 1001
5 SASI_Hs02_00309702 predicted 995
6 SASI_Hs02_00309703 predicted 992
7 SASI_Hs02_00309704 predicted 892
8 SASI_Hs02_00309705 predicted 847
9 SASI_Hs02_00309706 predicted 814
10 SASI_Hs02_00309707 predicted 796
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001809 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00332588 predicted 1077
2 SASI_Hs02_00332589 predicted 1094
3 SASI_Hs01_00035039 predicted 1056
4 SASI_Hs01_00035040 predicted 1085
5 SASI_Hs02_00332590 predicted 1068
6 SASI_Hs01_00035042 predicted 1072
7 SASI_Hs01_00035043 predicted 979
8 SASI_Hs02_00332591 predicted 927
9 SASI_Hs01_00035044 predicted 888
10 SASI_Hs02_00332592 predicted 790
11 SASI_Hs01_00035035 predicted 465
12 SASI_Hs01_00035036 predicted 494
13 SASI_Hs01_00035037 predicted 444
14 SASI_Hs01_00035038 predicted 481
15 SASI_Hs01_00035041 predicted 473
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106711 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00221638 predicted 789
2 SASI_Rn02_00221639 predicted 602
3 SASI_Rn02_00221640 predicted 387
4 SASI_Rn02_00221641 predicted 600
5 SASI_Rn02_00221642 predicted 261
6 SASI_Rn02_00221643 predicted 584
7 SASI_Rn02_00221644 predicted 748
8 SASI_Rn02_00221645 predicted 592
9 SASI_Rn02_00221646 predicted 194
10 SASI_Rn02_00221647 predicted 742
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007681 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00116427 predicted 474
2 SASI_Mm01_00116429 predicted 621
3 SASI_Mm01_00116430 predicted 572
4 SASI_Mm01_00116431 predicted 713
5 SASI_Mm01_00116435 predicted 620
6 SASI_Mm01_00116428 predicted 961
7 SASI_Mm02_00312208 predicted 966
8 SASI_Mm02_00312209 predicted 202
9 SASI_Mm01_00116436 predicted 890
10 SASI_Mm02_00312210 predicted 425
11 SASI_Mm01_00116432 predicted 279
12 SASI_Mm01_00116433 predicted 309
13 SASI_Mm01_00116434 predicted 299
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001809
VALIDATED
CENPA MISSION shRNA Bacterial Glycerol Stock
centromere protein A
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062693    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001809.2-759s1c1
Sequence:CCGGCCTCTGTAACAGAGGTAATATCTCGAGATATTACCTCTGTTACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001809.2-352s1c1
Sequence:CCGGCTGGCAAGAGAAATATGTGTTCTCGAGAACACATATTTCTCTTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001809.2-433s1c1
Sequence:CCGGGCAGCAGAAGCATTTCTAGTTCTCGAGAACTAGAAATGCTTCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001809.2-469s1c1
Sequence:CCGGGCCTATCTCCTCACCTTACATCTCGAGATGTAAGGTGAGGAGATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001809.2-495s1c1
Sequence:CCGGCCGAGTTACTCTCTTCCCAAACTCGAGTTTGGGAAGAGAGTAACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001809.3-309s21c1
Sequence:CCGGGCGGAGACAAGGTTGGCTAAACTCGAGTTTAGCCAACCTTGTCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296079    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001809.3-897s21c1
Sequence:CCGGAGTTACTCATGTGACTATTTGCTCGAGCAAATAGTCACATGAGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001809.3-472s21c1
Sequence:CCGGGCAGCAGAAGCATTTCTAGTTCTCGAGAACTAGAAATGCTTCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001809.3-534s21c1
Sequence:CCGGCCGAGTTACTCTCTTCCCAAACTCGAGTTTGGGAAGAGAGTAACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001809.3-419s21c1
Sequence:CCGGCTCGTGGTGTGGACTTCAATTCTCGAGAATTGAAGTCCACACCACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001809
VALIDATED
CENPA MISSION shRNA shRNA Plasmid DNA
centromere protein A
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062693    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001809.2-759s1c1
Sequence:CCGGCCTCTGTAACAGAGGTAATATCTCGAGATATTACCTCTGTTACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001809.2-352s1c1
Sequence:CCGGCTGGCAAGAGAAATATGTGTTCTCGAGAACACATATTTCTCTTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001809.2-433s1c1
Sequence:CCGGGCAGCAGAAGCATTTCTAGTTCTCGAGAACTAGAAATGCTTCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001809.2-469s1c1
Sequence:CCGGGCCTATCTCCTCACCTTACATCTCGAGATGTAAGGTGAGGAGATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001809.2-495s1c1
Sequence:CCGGCCGAGTTACTCTCTTCCCAAACTCGAGTTTGGGAAGAGAGTAACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001809.3-309s21c1
Sequence:CCGGGCGGAGACAAGGTTGGCTAAACTCGAGTTTAGCCAACCTTGTCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296079    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001809.3-897s21c1
Sequence:CCGGAGTTACTCATGTGACTATTTGCTCGAGCAAATAGTCACATGAGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001809.3-472s21c1
Sequence:CCGGGCAGCAGAAGCATTTCTAGTTCTCGAGAACTAGAAATGCTTCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001809.3-534s21c1
Sequence:CCGGCCGAGTTACTCTCTTCCCAAACTCGAGTTTGGGAAGAGAGTAACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001809.3-419s21c1
Sequence:CCGGCTCGTGGTGTGGACTTCAATTCTCGAGAATTGAAGTCCACACCACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001809
VALIDATED
CENPA MISSION shRNA Lentiviral Transduction Particles
centromere protein A
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062693    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001809.2-759s1c1
Sequence:CCGGCCTCTGTAACAGAGGTAATATCTCGAGATATTACCTCTGTTACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001809.2-352s1c1
Sequence:CCGGCTGGCAAGAGAAATATGTGTTCTCGAGAACACATATTTCTCTTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001809.2-433s1c1
Sequence:CCGGGCAGCAGAAGCATTTCTAGTTCTCGAGAACTAGAAATGCTTCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001809.2-469s1c1
Sequence:CCGGGCCTATCTCCTCACCTTACATCTCGAGATGTAAGGTGAGGAGATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001809.2-495s1c1
Sequence:CCGGCCGAGTTACTCTCTTCCCAAACTCGAGTTTGGGAAGAGAGTAACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001809.3-309s21c1
Sequence:CCGGGCGGAGACAAGGTTGGCTAAACTCGAGTTTAGCCAACCTTGTCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296079    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001809.3-897s21c1
Sequence:CCGGAGTTACTCATGTGACTATTTGCTCGAGCAAATAGTCACATGAGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001809.3-472s21c1
Sequence:CCGGGCAGCAGAAGCATTTCTAGTTCTCGAGAACTAGAAATGCTTCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001809.3-534s21c1
Sequence:CCGGCCGAGTTACTCTCTTCCCAAACTCGAGTTTGGGAAGAGAGTAACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001809.3-419s21c1
Sequence:CCGGCTCGTGGTGTGGACTTCAATTCTCGAGAATTGAAGTCCACACCACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007681
VALIDATED
CENPA MISSION shRNA Bacterial Glycerol Stock
centromere protein A
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093123    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007681.1-934s1c1
Sequence:CCGGCGCCATATAAATGCCTGCCTTCTCGAGAAGGCAGGCATTTATATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007681.1-312s1c1
Sequence:CCGGGCATGGTTGTTAGAGAAATATCTCGAGATATTTCTCTAACAACCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007681.1-484s1c1
Sequence:CCGGCATTCAGTTGACCAGGAGAATCTCGAGATTCTCCTGGTCAACTGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007681.1-233s1c1
Sequence:CCGGAGACAGAAATTCATGTGGCTTCTCGAGAAGCCACATGAATTTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007681.1-226s1c1
Sequence:CCGGGCGCAGAAGACAGAAATTCATCTCGAGATGAATTTCTGTCTTCTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007681.2-529s21c1
Sequence:CCGGCTAAGCTGCCAGTGGAATGTACTCGAGTACATTCCACTGGCAGCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007681.2-191s21c1
Sequence:CCGGTCGCGACAGAGCTCCAGTGTACTCGAGTACACTGGAGCTCTGTCGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007681.2-453s21c1
Sequence:CCGGATGCTGGTCGGGTCACGCTTTCTCGAGAAAGCGTGACCCGACCAGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007681.2-277s21c1
Sequence:CCGGGAGCACAGACCTCTTGTTCAGCTCGAGCTGAACAAGAGGTCTGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007681
VALIDATED
CENPA MISSION shRNA shRNA Plasmid DNA
centromere protein A
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093123    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007681.1-934s1c1
Sequence:CCGGCGCCATATAAATGCCTGCCTTCTCGAGAAGGCAGGCATTTATATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007681.1-312s1c1
Sequence:CCGGGCATGGTTGTTAGAGAAATATCTCGAGATATTTCTCTAACAACCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007681.1-484s1c1
Sequence:CCGGCATTCAGTTGACCAGGAGAATCTCGAGATTCTCCTGGTCAACTGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007681.1-233s1c1
Sequence:CCGGAGACAGAAATTCATGTGGCTTCTCGAGAAGCCACATGAATTTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007681.1-226s1c1
Sequence:CCGGGCGCAGAAGACAGAAATTCATCTCGAGATGAATTTCTGTCTTCTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007681.2-529s21c1
Sequence:CCGGCTAAGCTGCCAGTGGAATGTACTCGAGTACATTCCACTGGCAGCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007681.2-191s21c1
Sequence:CCGGTCGCGACAGAGCTCCAGTGTACTCGAGTACACTGGAGCTCTGTCGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007681.2-453s21c1
Sequence:CCGGATGCTGGTCGGGTCACGCTTTCTCGAGAAAGCGTGACCCGACCAGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007681.2-277s21c1
Sequence:CCGGGAGCACAGACCTCTTGTTCAGCTCGAGCTGAACAAGAGGTCTGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007681
VALIDATED
CENPA MISSION shRNA Lentiviral Transduction Particles
centromere protein A
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093123    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007681.1-934s1c1
Sequence:CCGGCGCCATATAAATGCCTGCCTTCTCGAGAAGGCAGGCATTTATATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007681.1-312s1c1
Sequence:CCGGGCATGGTTGTTAGAGAAATATCTCGAGATATTTCTCTAACAACCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007681.1-484s1c1
Sequence:CCGGCATTCAGTTGACCAGGAGAATCTCGAGATTCTCCTGGTCAACTGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007681.1-233s1c1
Sequence:CCGGAGACAGAAATTCATGTGGCTTCTCGAGAAGCCACATGAATTTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007681.1-226s1c1
Sequence:CCGGGCGCAGAAGACAGAAATTCATCTCGAGATGAATTTCTGTCTTCTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007681.2-529s21c1
Sequence:CCGGCTAAGCTGCCAGTGGAATGTACTCGAGTACATTCCACTGGCAGCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007681.2-191s21c1
Sequence:CCGGTCGCGACAGAGCTCCAGTGTACTCGAGTACACTGGAGCTCTGTCGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007681.2-453s21c1
Sequence:CCGGATGCTGGTCGGGTCACGCTTTCTCGAGAAAGCGTGACCCGACCAGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007681.2-277s21c1
Sequence:CCGGGAGCACAGACCTCTTGTTCAGCTCGAGCTGAACAAGAGGTCTGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks