EMAIL THIS PAGE TO A FRIEND

CENPB

centromere protein B, 80kDa

130 Gene Product Result for
UniProtKB ID: P07199
Gene ID:
Human(1059) Summary: This gene product is a highly conserved protein that facilitates centromere formation. It is a DNA-binding protein that is derived from transposases of the pogo DNA transposon family. It contains a helix-loop-helix DNA binding motif at the N-terminus, and a dimerization domain at the C-terminus. The DNA binding domain recognizes and binds a 17-bp sequence (CENP-B box) in the centromeric alpha satellite DNA. This protein is proposed to play an important role in the assembly of specific centromere structures in interphase nuclei and on mitotic chromosomes. It is also considered a major centromere autoantigen recognized by sera from patients with anti-centromere antibodies. [provided by RefSeq, Jul 2008]
Mouse(12616) centromere protein B
Rat(362217) centromere protein B
naked mole-rat(101700720) centromere protein B, 80kDa
domestic guinea pig(100713491) centromere protein B, 80kDa
sheep(101110697) centromere protein B, 80kDa
cow(281680) centromere protein B, 80kDa
dog(485791) centromere protein B, 80kDa
cow(788381) centromere protein B, 80kDa
domestic cat(101093012) centromere protein B, 80kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001810 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001810 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001810 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007682 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007682 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007682 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU049481 MISSION® esiRNA esiRNA targeting mouse Cenpb (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001810 Rosetta Predictions human pricing
XM_001081194 Rosetta Predictions rat pricing
XM_342521 Rosetta Predictions rat pricing
NM_007682 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001810 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00143410 predicted 410
2 SASI_Hs01_00143411 predicted 794
3 SASI_Hs01_00143412 predicted 2189
4 SASI_Hs01_00143413 predicted 1128
5 SASI_Hs01_00143414 predicted 405
6 SASI_Hs01_00143415 predicted 774
7 SASI_Hs01_00143416 predicted 1027
8 SASI_Hs01_00143417 predicted 2108
9 SASI_Hs01_00143418 predicted 890
10 SASI_Hs01_00143419 predicted 978
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081194 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00370988 predicted 353
2 SASI_Rn02_00370989 predicted 996
3 SASI_Rn02_00370990 predicted 2328
4 SASI_Rn02_00370991 predicted 775
5 SASI_Rn02_00370992 predicted 660
6 SASI_Rn02_00370993 predicted 644
7 SASI_Rn02_00370994 predicted 2275
8 SASI_Rn02_00370995 predicted 893
9 SASI_Rn02_00370996 predicted 2264
10 SASI_Rn02_00370997 predicted 1030
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342521 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00394419 predicted 324
2 SASI_Rn02_00394420 predicted 973
3 SASI_Rn02_00394421 predicted 2309
4 SASI_Rn02_00394422 predicted 754
5 SASI_Rn02_00394423 predicted 641
6 SASI_Rn02_00394424 predicted 620
7 SASI_Rn02_00394425 predicted 2255
8 SASI_Rn02_00394426 predicted 874
9 SASI_Rn02_00394427 predicted 2245
10 SASI_Rn02_00394428 predicted 1013
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007682 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00155961 predicted 407
2 SASI_Mm01_00155964 predicted 898
3 SASI_Mm01_00155966 predicted 2198
4 SASI_Mm01_00155967 predicted 957
5 SASI_Mm01_00155968 predicted 417
6 SASI_Mm01_00155969 predicted 2371
7 SASI_Mm01_00155970 predicted 726
8 SASI_Mm02_00312211 predicted 912
9 SASI_Mm02_00312212 predicted 2052
10 SASI_Mm02_00312213 predicted 2237
11 SASI_Mm01_00155962 predicted 2110
12 SASI_Mm01_00155963 predicted 2116
13 SASI_Mm01_00155965 predicted 2337
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001810
CENPB MISSION shRNA Bacterial Glycerol Stock
centromere protein B, 80kDa
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000446258    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001810.5-2183s21c1
Sequence:CCGGAGCCTCACTGCCTGCTTATTGCTCGAGCAATAAGCAGGCAGTGAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001810.5-1924s1c1
Sequence:CCGGCACTTGGAACACGATCTGGTTCTCGAGAACCAGATCGTGTTCCAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152184    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001810.5-2109s1c1
Sequence:CCGGCCAGATCCTTTAGTAATGCTTCTCGAGAAGCATTACTAAAGGATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001810.5-1780s1c1
Sequence:CCGGGAAGATGAAGACGACGATGATCTCGAGATCATCGTCGTCTTCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001810.5-333s1c1
Sequence:CCGGGAGCACGATCCTGAAGAACAACTCGAGTTGTTCTTCAGGATCGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154546    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001810.5-1798s1c1
Sequence:CCGGGATGATGAGGAGGATGGTGATCTCGAGATCACCATCCTCCTCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001810.5-1702s1c1
Sequence:CCGGCCTACTCTGCATTTCCTGGAACTCGAGTTCCAGGAAATGCAGAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001810
CENPB MISSION shRNA shRNA Plasmid DNA
centromere protein B, 80kDa
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000446258    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001810.5-2183s21c1
Sequence:CCGGAGCCTCACTGCCTGCTTATTGCTCGAGCAATAAGCAGGCAGTGAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001810.5-1924s1c1
Sequence:CCGGCACTTGGAACACGATCTGGTTCTCGAGAACCAGATCGTGTTCCAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152184    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001810.5-2109s1c1
Sequence:CCGGCCAGATCCTTTAGTAATGCTTCTCGAGAAGCATTACTAAAGGATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001810.5-1780s1c1
Sequence:CCGGGAAGATGAAGACGACGATGATCTCGAGATCATCGTCGTCTTCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001810.5-333s1c1
Sequence:CCGGGAGCACGATCCTGAAGAACAACTCGAGTTGTTCTTCAGGATCGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154546    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001810.5-1798s1c1
Sequence:CCGGGATGATGAGGAGGATGGTGATCTCGAGATCACCATCCTCCTCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001810.5-1702s1c1
Sequence:CCGGCCTACTCTGCATTTCCTGGAACTCGAGTTCCAGGAAATGCAGAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001810
CENPB MISSION shRNA Lentiviral Transduction Particles
centromere protein B, 80kDa
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000446258    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001810.5-2183s21c1
Sequence:CCGGAGCCTCACTGCCTGCTTATTGCTCGAGCAATAAGCAGGCAGTGAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001810.5-1924s1c1
Sequence:CCGGCACTTGGAACACGATCTGGTTCTCGAGAACCAGATCGTGTTCCAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152184    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001810.5-2109s1c1
Sequence:CCGGCCAGATCCTTTAGTAATGCTTCTCGAGAAGCATTACTAAAGGATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001810.5-1780s1c1
Sequence:CCGGGAAGATGAAGACGACGATGATCTCGAGATCATCGTCGTCTTCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001810.5-333s1c1
Sequence:CCGGGAGCACGATCCTGAAGAACAACTCGAGTTGTTCTTCAGGATCGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154546    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001810.5-1798s1c1
Sequence:CCGGGATGATGAGGAGGATGGTGATCTCGAGATCACCATCCTCCTCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001810.5-1702s1c1
Sequence:CCGGCCTACTCTGCATTTCCTGGAACTCGAGTTCCAGGAAATGCAGAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007682
VALIDATED
CENPB MISSION shRNA Bacterial Glycerol Stock
centromere protein B, 80kDa
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000217912    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007682.2-1529s1c1
Sequence:CCGGGAAAGTTCCTCTGAGGGTTTACTCGAGTAAACCCTCAGAGGAACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240537    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_007682.2-2379s21c1
Sequence:CCGGCTCCTGCATCTCTAGGCTAAACTCGAGTTTAGCCTAGAGATGCAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_007682.2-1838s21c1
Sequence:CCGGCAGAGTCACATCCTTCATTTGCTCGAGCAAATGAAGGATGTGACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_007682.2-1492s21c1
Sequence:CCGGGGAAGGTGAGGTTGATGATAGCTCGAGCTATCATCAACCTCACCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_007682.2-1529s21c1
Sequence:CCGGGAAAGTTCCTCTGAGGGTTTACTCGAGTAAACCCTCAGAGGAACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194613    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007682.2-1679s1c1
Sequence:CCGGGATGAAGAGGAGGACGATGAACTCGAGTTCATCGTCCTCCTCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176282    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007682.2-1837s1c1
Sequence:CCGGGCAGAGTCACATCCTTCATTTCTCGAGAAATGAAGGATGTGACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007682
VALIDATED
CENPB MISSION shRNA shRNA Plasmid DNA
centromere protein B, 80kDa
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000217912    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007682.2-1529s1c1
Sequence:CCGGGAAAGTTCCTCTGAGGGTTTACTCGAGTAAACCCTCAGAGGAACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240537    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_007682.2-2379s21c1
Sequence:CCGGCTCCTGCATCTCTAGGCTAAACTCGAGTTTAGCCTAGAGATGCAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_007682.2-1838s21c1
Sequence:CCGGCAGAGTCACATCCTTCATTTGCTCGAGCAAATGAAGGATGTGACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_007682.2-1492s21c1
Sequence:CCGGGGAAGGTGAGGTTGATGATAGCTCGAGCTATCATCAACCTCACCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_007682.2-1529s21c1
Sequence:CCGGGAAAGTTCCTCTGAGGGTTTACTCGAGTAAACCCTCAGAGGAACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194613    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007682.2-1679s1c1
Sequence:CCGGGATGAAGAGGAGGACGATGAACTCGAGTTCATCGTCCTCCTCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176282    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007682.2-1837s1c1
Sequence:CCGGGCAGAGTCACATCCTTCATTTCTCGAGAAATGAAGGATGTGACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007682
VALIDATED
CENPB MISSION shRNA Lentiviral Transduction Particles
centromere protein B, 80kDa
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000217912    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007682.2-1529s1c1
Sequence:CCGGGAAAGTTCCTCTGAGGGTTTACTCGAGTAAACCCTCAGAGGAACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240537    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_007682.2-2379s21c1
Sequence:CCGGCTCCTGCATCTCTAGGCTAAACTCGAGTTTAGCCTAGAGATGCAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_007682.2-1838s21c1
Sequence:CCGGCAGAGTCACATCCTTCATTTGCTCGAGCAAATGAAGGATGTGACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_007682.2-1492s21c1
Sequence:CCGGGGAAGGTGAGGTTGATGATAGCTCGAGCTATCATCAACCTCACCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_007682.2-1529s21c1
Sequence:CCGGGAAAGTTCCTCTGAGGGTTTACTCGAGTAAACCCTCAGAGGAACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194613    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007682.2-1679s1c1
Sequence:CCGGGATGAAGAGGAGGACGATGAACTCGAGTTCATCGTCCTCCTCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176282    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007682.2-1837s1c1
Sequence:CCGGGCAGAGTCACATCCTTCATTTCTCGAGAAATGAAGGATGTGACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks