EMAIL THIS PAGE TO A FRIEND

CENPBD1

CENPB DNA-binding domains containing 1

UniProtKB ID: B2RD01
Gene ID:
dog(100683197) CENPB DNA-binding domains containing 1
cow(526543) CENPB DNA-binding domains containing 1
87 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032690 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032690 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032690 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145039 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145039 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00104334 predicted 716
2 SASI_Hs01_00104335 predicted 769
3 SASI_Hs01_00104336 predicted 841
4 SASI_Hs01_00104337 predicted 831
5 SASI_Hs01_00104338 predicted 742
6 SASI_Hs01_00104339 predicted 770
7 SASI_Hs01_00104340 predicted 825
8 SASI_Hs01_00104341 predicted 971
9 SASI_Hs02_00364914 predicted 632
10 SASI_Hs02_00364915 predicted 677
11 SASI_Hs01_00104333 predicted 684
12 SASI_Hs01_00104342 predicted 1009
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032690
CENPBD1 MISSION shRNA Bacterial Glycerol Stock
CENPB DNA-binding domains containing 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164620    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032690.1-532s1c1
Sequence:CCGGCATTGTGACCCTTGCCAGAAACTCGAGTTTCTGGCAAGGGTCACAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158591    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032690.1-605s1c1
Sequence:CCGGCATGAAGAAGATCTCTCAAATCTCGAGATTTGAGAGATCTTCTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160002    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032690.1-604s1c1
Sequence:CCGGCCATGAAGAAGATCTCTCAAACTCGAGTTTGAGAGATCTTCTTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160689    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032690.1-440s1c1
Sequence:CCGGCTAATGAACAGCATGTGGAAGCTCGAGCTTCCACATGCTGTTCATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160994    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032690.1-445s1c1
Sequence:CCGGGAACAGCATGTGGAAGAAGATCTCGAGATCTTCTTCCACATGCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163022    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032690.1-463s1c1
Sequence:CCGGGATTTGGCCTGAGTGTGTTCACTCGAGTGAACACACTCAGGCCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163212    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032690.1-457s1c1
Sequence:CCGGGAAGAAGATTTGGCCTGAGTGCTCGAGCACTCAGGCCAAATCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163499    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032690.1-545s1c1
Sequence:CCGGGCCAGAAATGTGGCCTTTGAACTCGAGTTCAAAGGCCACATTTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164530    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032690.1-499s1c1
Sequence:CCGGCCAGGCAGATAACATTGCACACTCGAGTGTGCAATGTTATCTGCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032690
CENPBD1 MISSION shRNA shRNA Plasmid DNA
CENPB DNA-binding domains containing 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164620    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032690.1-532s1c1
Sequence:CCGGCATTGTGACCCTTGCCAGAAACTCGAGTTTCTGGCAAGGGTCACAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158591    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032690.1-605s1c1
Sequence:CCGGCATGAAGAAGATCTCTCAAATCTCGAGATTTGAGAGATCTTCTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160002    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032690.1-604s1c1
Sequence:CCGGCCATGAAGAAGATCTCTCAAACTCGAGTTTGAGAGATCTTCTTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160689    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032690.1-440s1c1
Sequence:CCGGCTAATGAACAGCATGTGGAAGCTCGAGCTTCCACATGCTGTTCATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160994    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032690.1-445s1c1
Sequence:CCGGGAACAGCATGTGGAAGAAGATCTCGAGATCTTCTTCCACATGCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163022    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032690.1-463s1c1
Sequence:CCGGGATTTGGCCTGAGTGTGTTCACTCGAGTGAACACACTCAGGCCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163212    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032690.1-457s1c1
Sequence:CCGGGAAGAAGATTTGGCCTGAGTGCTCGAGCACTCAGGCCAAATCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163499    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032690.1-545s1c1
Sequence:CCGGGCCAGAAATGTGGCCTTTGAACTCGAGTTCAAAGGCCACATTTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164530    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032690.1-499s1c1
Sequence:CCGGCCAGGCAGATAACATTGCACACTCGAGTGTGCAATGTTATCTGCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032690
CENPBD1 MISSION shRNA Lentiviral Transduction Particles
CENPB DNA-binding domains containing 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164620    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032690.1-532s1c1
Sequence:CCGGCATTGTGACCCTTGCCAGAAACTCGAGTTTCTGGCAAGGGTCACAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158591    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032690.1-605s1c1
Sequence:CCGGCATGAAGAAGATCTCTCAAATCTCGAGATTTGAGAGATCTTCTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160002    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032690.1-604s1c1
Sequence:CCGGCCATGAAGAAGATCTCTCAAACTCGAGTTTGAGAGATCTTCTTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160689    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032690.1-440s1c1
Sequence:CCGGCTAATGAACAGCATGTGGAAGCTCGAGCTTCCACATGCTGTTCATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160994    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032690.1-445s1c1
Sequence:CCGGGAACAGCATGTGGAAGAAGATCTCGAGATCTTCTTCCACATGCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163022    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032690.1-463s1c1
Sequence:CCGGGATTTGGCCTGAGTGTGTTCACTCGAGTGAACACACTCAGGCCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163212    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032690.1-457s1c1
Sequence:CCGGGAAGAAGATTTGGCCTGAGTGCTCGAGCACTCAGGCCAAATCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163499    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032690.1-545s1c1
Sequence:CCGGGCCAGAAATGTGGCCTTTGAACTCGAGTTCAAAGGCCACATTTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164530    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032690.1-499s1c1
Sequence:CCGGCCAGGCAGATAACATTGCACACTCGAGTGTGCAATGTTATCTGCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks