EMAIL THIS PAGE TO A FRIEND

CENPE

centromere protein E, 312kDa

76 Gene Product Result for
Synonyms: CENP-E KIF10 PPP1R61
UniProtKB ID: Q02224, A6NKY9, A8K2U7, Q4LE75
Gene ID:
Human(1062) Summary: Centrosome-associated protein E is a kinesin-like motor protein that accumulates in the G2 phase of the cell cycle. Unlike other centrosome-associated proteins, it is not present during interphase and first appears at the centromere region of chromosomes during prometaphase. CENPE is proposed to be one of the motors responsible for mammalian chromosome movement and/or spindle elongation. [provided by RefSeq, Jul 2008]
Mouse(229841) centromere protein E
Rat(362044) centromere protein E
Zebrafish(767754) centromere protein E
chicken(422716) centromere protein E, 312kDa
dog(610125) centromere protein E, 312kDa
domestic cat(101093853) centromere protein E, 312kDa
cow(281681) centromere protein E, 312kDa
Horse(100068227) centromere protein E, 312kDa
sheep(101105752) centromere protein E, 312kDa
Domestic Rabbit(100343917) centromere protein E, 312kDa
naked mole-rat(101712243) centromere protein E, 312kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173762 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173762 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173762 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001813 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001813 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001813 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001813 Rosetta Predictions human pricing
XM_001077739 Rosetta Predictions rat pricing
XM_342345 Rosetta Predictions rat pricing
NM_173762 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001813 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00200393 predicted 2500
2 SASI_Hs01_00200394 predicted 2453
3 SASI_Hs01_00200395 predicted 699
4 SASI_Hs01_00200396 predicted 990
5 SASI_Hs01_00200397 predicted 8250
6 SASI_Hs01_00200398 predicted 3256
7 SASI_Hs01_00200399 predicted 1381
8 SASI_Hs01_00200400 predicted 6859
9 SASI_Hs02_00332595 predicted 6335
10 SASI_Hs02_00332596 predicted 296
11 SASI_Hs01_00200401 predicted 4624
12 SASI_Hs01_00200402 predicted 1759
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077739 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00358305 predicted 4154
2 SASI_Rn02_00358306 predicted 1030
3 SASI_Rn02_00358307 predicted 5585
4 SASI_Rn02_00358308 predicted 3775
5 SASI_Rn02_00358309 predicted 5199
6 SASI_Rn02_00358310 predicted 3324
7 SASI_Rn02_00358311 predicted 217
8 SASI_Rn02_00358312 predicted 5842
9 SASI_Rn02_00358313 predicted 4238
10 SASI_Rn02_00358314 predicted 797
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342345 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00394157 predicted 2698
2 SASI_Rn02_00394158 predicted 4128
3 SASI_Rn02_00394159 predicted 1027
4 SASI_Rn02_00394160 predicted 5569
5 SASI_Rn02_00394161 predicted 3759
6 SASI_Rn02_00394162 predicted 5173
7 SASI_Rn02_00394163 predicted 3321
8 SASI_Rn02_00394164 predicted 223
9 SASI_Rn02_00394165 predicted 5824
10 SASI_Rn02_00394166 predicted 4220
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173762 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00051850 predicted 3693
2 SASI_Mm01_00051851 predicted 5089
3 SASI_Mm01_00051852 predicted 4659
4 SASI_Mm01_00051853 predicted 4140
5 SASI_Mm02_00345414 predicted 6113
6 SASI_Mm01_00051854 predicted 1607
7 SASI_Mm01_00051855 predicted 842
8 SASI_Mm02_00345415 predicted 201
9 SASI_Mm01_00051856 predicted 5232
10 SASI_Mm02_00345416 predicted 4819
11 SASI_Mm01_00051847 predicted 3948
12 SASI_Mm01_00051848 predicted 4098
13 SASI_Mm01_00051849 predicted 3737
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173762
VALIDATED
CENPE MISSION shRNA Bacterial Glycerol Stock
centromere protein E, 312kDa
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173762.3-4827s1c1
Sequence:CCGGCCTTGAAGAAACGGTAACTAACTCGAGTTAGTTACCGTTTCTTCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173762.3-4838s1c1
Sequence:CCGGCGGTAACTAAAGGTATGGAAACTCGAGTTTCCATACCTTTAGTTACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173762.3-1409s1c1
Sequence:CCGGCCGAGTTTGAAATGTTGAATACTCGAGTATTCAACATTTCAAACTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173762.3-3120s1c1
Sequence:CCGGCGACTCTCTAATGCAGGAGAACTCGAGTTCTCCTGCATTAGAGAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173762.3-6066s1c1
Sequence:CCGGGCAGCATGAGTCCATCAATAACTCGAGTTATTGATGGACTCATGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173762.4-3216s21c1
Sequence:CCGGCGACTCTCTAATGCAGGAGAACTCGAGTTCTCCTGCATTAGAGAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173762.4-1505s21c1
Sequence:CCGGCCGAGTTTGAAATGTTGAATACTCGAGTATTCAACATTTCAAACTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294860    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173762.4-7623s21c1
Sequence:CCGGACTTAGTTTCAGTCTAATTTCCTCGAGGAAATTAGACTGAAACTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173762.4-3060s21c1
Sequence:CCGGTGAGGAACTATCCGATAATTTCTCGAGAAATTATCGGATAGTTCCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173762.4-6153s21c1
Sequence:CCGGGCAGCATGAGTCCATCAATAACTCGAGTTATTGATGGACTCATGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173762
VALIDATED
CENPE MISSION shRNA shRNA Plasmid DNA
centromere protein E, 312kDa
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173762.3-4827s1c1
Sequence:CCGGCCTTGAAGAAACGGTAACTAACTCGAGTTAGTTACCGTTTCTTCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173762.3-4838s1c1
Sequence:CCGGCGGTAACTAAAGGTATGGAAACTCGAGTTTCCATACCTTTAGTTACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173762.3-1409s1c1
Sequence:CCGGCCGAGTTTGAAATGTTGAATACTCGAGTATTCAACATTTCAAACTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173762.3-3120s1c1
Sequence:CCGGCGACTCTCTAATGCAGGAGAACTCGAGTTCTCCTGCATTAGAGAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173762.3-6066s1c1
Sequence:CCGGGCAGCATGAGTCCATCAATAACTCGAGTTATTGATGGACTCATGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173762.4-3216s21c1
Sequence:CCGGCGACTCTCTAATGCAGGAGAACTCGAGTTCTCCTGCATTAGAGAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173762.4-1505s21c1
Sequence:CCGGCCGAGTTTGAAATGTTGAATACTCGAGTATTCAACATTTCAAACTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294860    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173762.4-7623s21c1
Sequence:CCGGACTTAGTTTCAGTCTAATTTCCTCGAGGAAATTAGACTGAAACTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173762.4-3060s21c1
Sequence:CCGGTGAGGAACTATCCGATAATTTCTCGAGAAATTATCGGATAGTTCCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173762.4-6153s21c1
Sequence:CCGGGCAGCATGAGTCCATCAATAACTCGAGTTATTGATGGACTCATGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173762
VALIDATED
CENPE MISSION shRNA Lentiviral Transduction Particles
centromere protein E, 312kDa
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173762.3-4827s1c1
Sequence:CCGGCCTTGAAGAAACGGTAACTAACTCGAGTTAGTTACCGTTTCTTCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173762.3-4838s1c1
Sequence:CCGGCGGTAACTAAAGGTATGGAAACTCGAGTTTCCATACCTTTAGTTACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173762.3-1409s1c1
Sequence:CCGGCCGAGTTTGAAATGTTGAATACTCGAGTATTCAACATTTCAAACTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173762.3-3120s1c1
Sequence:CCGGCGACTCTCTAATGCAGGAGAACTCGAGTTCTCCTGCATTAGAGAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173762.3-6066s1c1
Sequence:CCGGGCAGCATGAGTCCATCAATAACTCGAGTTATTGATGGACTCATGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173762.4-3216s21c1
Sequence:CCGGCGACTCTCTAATGCAGGAGAACTCGAGTTCTCCTGCATTAGAGAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173762.4-1505s21c1
Sequence:CCGGCCGAGTTTGAAATGTTGAATACTCGAGTATTCAACATTTCAAACTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294860    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173762.4-7623s21c1
Sequence:CCGGACTTAGTTTCAGTCTAATTTCCTCGAGGAAATTAGACTGAAACTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173762.4-3060s21c1
Sequence:CCGGTGAGGAACTATCCGATAATTTCTCGAGAAATTATCGGATAGTTCCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173762.4-6153s21c1
Sequence:CCGGGCAGCATGAGTCCATCAATAACTCGAGTTATTGATGGACTCATGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001813
CENPE MISSION shRNA Bacterial Glycerol Stock
centromere protein E, 312kDa
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108300    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001813.2-8317s1c1
Sequence:CCGGGCCACTAGAGTTGAAAGATAACTCGAGTTATCTTTCAACTCTAGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001813.2-653s1c1
Sequence:CCGGGCAGGCATTATGGAGAAACAACTCGAGTTGTTTCTCCATAATGCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001813.2-6844s1c1
Sequence:CCGGCCTAGCATAAAGACTGAATTTCTCGAGAAATTCAGTCTTTATGCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001813.2-4322s1c1
Sequence:CCGGCCAAAGATTCAGCACTACTAACTCGAGTTAGTAGTGCTGAATCTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001813.2-5445s1c1
Sequence:CCGGGCAGCAGGAAACTATTGACAACTCGAGTTGTCAATAGTTTCCTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001813.2-936s21c1
Sequence:CCGGTTATCGAGATAGCAAGTTAACCTCGAGGTTAACTTGCTATCTCGATAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001813.2-2506s21c1
Sequence:CCGGGCAACTACACAGTCGAATTATCTCGAGATAATTCGACTGTGTAGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001813.2-3739s21c1
Sequence:CCGGGACCACCTTAGAGGATATATACTCGAGTATATATCCTCTAAGGTGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001813.2-8052s21c1
Sequence:CCGGACCTCATCCAGTTCGCTATTTCTCGAGAAATAGCGAACTGGATGAGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001813
CENPE MISSION shRNA shRNA Plasmid DNA
centromere protein E, 312kDa
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108300    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001813.2-8317s1c1
Sequence:CCGGGCCACTAGAGTTGAAAGATAACTCGAGTTATCTTTCAACTCTAGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001813.2-653s1c1
Sequence:CCGGGCAGGCATTATGGAGAAACAACTCGAGTTGTTTCTCCATAATGCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001813.2-6844s1c1
Sequence:CCGGCCTAGCATAAAGACTGAATTTCTCGAGAAATTCAGTCTTTATGCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001813.2-4322s1c1
Sequence:CCGGCCAAAGATTCAGCACTACTAACTCGAGTTAGTAGTGCTGAATCTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001813.2-5445s1c1
Sequence:CCGGGCAGCAGGAAACTATTGACAACTCGAGTTGTCAATAGTTTCCTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001813.2-936s21c1
Sequence:CCGGTTATCGAGATAGCAAGTTAACCTCGAGGTTAACTTGCTATCTCGATAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001813.2-2506s21c1
Sequence:CCGGGCAACTACACAGTCGAATTATCTCGAGATAATTCGACTGTGTAGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001813.2-3739s21c1
Sequence:CCGGGACCACCTTAGAGGATATATACTCGAGTATATATCCTCTAAGGTGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001813.2-8052s21c1
Sequence:CCGGACCTCATCCAGTTCGCTATTTCTCGAGAAATAGCGAACTGGATGAGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001813
CENPE MISSION shRNA Lentiviral Transduction Particles
centromere protein E, 312kDa
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108300    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001813.2-8317s1c1
Sequence:CCGGGCCACTAGAGTTGAAAGATAACTCGAGTTATCTTTCAACTCTAGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001813.2-653s1c1
Sequence:CCGGGCAGGCATTATGGAGAAACAACTCGAGTTGTTTCTCCATAATGCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001813.2-6844s1c1
Sequence:CCGGCCTAGCATAAAGACTGAATTTCTCGAGAAATTCAGTCTTTATGCTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001813.2-4322s1c1
Sequence:CCGGCCAAAGATTCAGCACTACTAACTCGAGTTAGTAGTGCTGAATCTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001813.2-5445s1c1
Sequence:CCGGGCAGCAGGAAACTATTGACAACTCGAGTTGTCAATAGTTTCCTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001813.2-936s21c1
Sequence:CCGGTTATCGAGATAGCAAGTTAACCTCGAGGTTAACTTGCTATCTCGATAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001813.2-2506s21c1
Sequence:CCGGGCAACTACACAGTCGAATTATCTCGAGATAATTCGACTGTGTAGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001813.2-3739s21c1
Sequence:CCGGGACCACCTTAGAGGATATATACTCGAGTATATATCCTCTAAGGTGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001813.2-8052s21c1
Sequence:CCGGACCTCATCCAGTTCGCTATTTCTCGAGAAATAGCGAACTGGATGAGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)