EMAIL THIS PAGE TO A FRIEND

CENPF

centromere protein F, 350/400kDa

130 Gene Product Result for
Synonyms: CENF PRO1779 hcp-1
UniProtKB ID: P49454, Q13171, Q13246, Q5VVM7
Gene ID:
Human(1063) Summary: This gene encodes a protein that associates with the centromere-kinetochore complex. The protein is a component of the nuclear matrix during the G2 phase of interphase. In late G2 the protein associates with the kinetochore and maintains this association through early anaphase. It localizes to the spindle midzone and the intracellular bridge in late anaphase and telophase, respectively, and is thought to be subsequently degraded. The localization of this protein suggests that it may play a role in chromosome segregation during mitotis. It is thought to form either a homodimer or heterodimer. Autoantibodies against this protein have been found in patients with cancer or graft versus host disease. [provided by RefSeq, Jul 2008]
Mouse(108000) centromere protein F
Rat(257649) centromere protein F
naked mole-rat(101721145) centromere protein F, 350/400kDa
domestic guinea pig(100720167) centromere protein F, 350/400kDa
sheep(101112149) centromere protein F, 350/400kDa (mitosin)
Zebrafish(497403) centromere protein F, (mitosin)
chicken(395357) centromere protein F, 350/400kDa (mitosin)
cow(533089) centromere protein F, 350/400kDa (mitosin)
Horse(100050180) centromere protein F, 350/400kDa (mitosin)
dog(480027) centromere protein F, 350/400kDa (mitosin)
domestic cat(101096944) centromere protein F, 350/400kDa (mitosin)
dog(610263) centromere protein F, 350/400kDa (mitosin)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2700002 Anti-CENPF (C-terminal) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunofluorescence, immunohistochemistry, western blot pricing
HPA052382 Anti-CENPF antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB2702140 Monoclonal Anti-CENPF antibody produced in mouse human
immunocytochemistry, immunofluorescence, immunohistochemistry, immunoprecipitation, western blot pricing
SAB2702181 Monoclonal Anti-CENPF antibody produced in mouse human
immunocytochemistry, immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016343 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016343 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016343 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081363 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081363 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081363 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016343 Rosetta Predictions human pricing
XM_001067266 Rosetta Predictions rat pricing
XM_223060 Rosetta Predictions rat pricing
NM_001081363 Rosetta Predictions mouse pricing
XM_129658 Rosetta Predictions mouse pricing
XM_899897 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016343 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00162646 predicted 627
2 SASI_Hs01_00162647 predicted 940
3 SASI_Hs01_00162648 predicted 3891
4 SASI_Hs02_00349299 predicted 5605
5 SASI_Hs02_00349300 predicted 8259
6 SASI_Hs01_00162650 predicted 9370
7 SASI_Hs01_00162651 predicted 7549
8 SASI_Hs02_00349301 predicted 2992
9 SASI_Hs01_00162652 predicted 2349
10 SASI_Hs02_00349302 predicted 772
11 SASI_Hs01_00162649 predicted 5163
12 SASI_Hs01_00162653 predicted 5117
13 SASI_Hs01_00162654 predicted 1925
14 SASI_Hs01_00162655 predicted 7164
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067266 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00320446 predicted 346
2 SASI_Rn02_00320447 predicted 8186
3 SASI_Rn02_00320448 predicted 8536
4 SASI_Rn02_00320449 predicted 6316
5 SASI_Rn02_00320450 predicted 5411
6 SASI_Rn02_00320451 predicted 3441
7 SASI_Rn02_00320452 predicted 7716
8 SASI_Rn02_00320453 predicted 4612
9 SASI_Rn02_00320454 predicted 7652
10 SASI_Rn02_00320455 predicted 7985
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_223060 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00381084 predicted 8184
2 SASI_Rn02_00381085 predicted 8535
3 SASI_Rn02_00381086 predicted 6314
4 SASI_Rn02_00381087 predicted 6254
5 SASI_Rn02_00381088 predicted 5787
6 SASI_Rn02_00381089 predicted 5412
7 SASI_Rn02_00381090 predicted 3434
8 SASI_Rn02_00381091 predicted 7711
9 SASI_Rn02_00381092 predicted 4616
10 SASI_Rn02_00381093 predicted 7658
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081363 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00297681 predicted 9203
2 SASI_Mm02_00297682 predicted 3531
3 SASI_Mm02_00297683 predicted 402
4 SASI_Mm02_00297684 predicted 5386
5 SASI_Mm02_00297685 predicted 8524
6 SASI_Mm02_00297686 predicted 7042
7 SASI_Mm02_00297687 predicted 9223
8 SASI_Mm02_00297688 predicted 4133
9 SASI_Mm02_00297689 predicted 5690
10 SASI_Mm02_00297690 predicted 6745
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_129658 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00218430 predicted 3486
2 SASI_Mm01_00218431 predicted 3324
3 SASI_Mm01_00218432 predicted 5343
4 SASI_Mm01_00218433 predicted 1814
5 SASI_Mm01_00218434 predicted 6994
6 SASI_Mm01_00218435 predicted 4088
7 SASI_Mm01_00218436 predicted 5848
8 SASI_Mm01_00218437 predicted 5645
9 SASI_Mm01_00218438 predicted 1430
10 SASI_Mm01_00218439 predicted 6700
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899897 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00209796 predicted 3503
2 SASI_Mm01_00209797 predicted 5365
3 SASI_Mm01_00209798 predicted 1888
4 SASI_Mm01_00209799 predicted 7020
5 SASI_Mm01_00209800 predicted 4104
6 SASI_Mm01_00209801 predicted 5875
7 SASI_Mm01_00209802 predicted 5663
8 SASI_Mm01_00209803 predicted 1497
9 SASI_Mm01_00209804 predicted 6732
10 SASI_Mm01_00209805 predicted 4295
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016343
VALIDATED
CENPF MISSION shRNA Bacterial Glycerol Stock
centromere protein F, 350/400kDa
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000288967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016343.3-1579s21c1
Sequence:CCGGGCGAGTCAGATCAAGGAGAATCTCGAGATTCTCCTTGATCTGACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016343.3-5809s21c1
Sequence:CCGGCGTGAAGATATTGGAGATAATCTCGAGATTATCTCCAATATCTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288970    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016343.3-9724s21c1
Sequence:CCGGCCATTCCTCTACTGCAATGTACTCGAGTACATTGCAGTAGAGGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016343.3-3876s21c1
Sequence:CCGGGCAGCATGAATTACAGACAATCTCGAGATTGTCTGTAATTCATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016343.3-3092s21c1
Sequence:CCGGCCCAAGAGAATGGGACTCTTACTCGAGTAAGAGTCCCATTCTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062673    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016343.3-9724s1c1
Sequence:CCGGCCATTCCTCTACTGCAATGTACTCGAGTACATTGCAGTAGAGGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016343.3-3092s1c1
Sequence:CCGGCCCAAGAGAATGGGACTCTTACTCGAGTAAGAGTCCCATTCTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016343.3-3876s1c1
Sequence:CCGGGCAGCATGAATTACAGACAATCTCGAGATTGTCTGTAATTCATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016343.3-1579s1c1
Sequence:CCGGGCGAGTCAGATCAAGGAGAATCTCGAGATTCTCCTTGATCTGACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016343.3-5809s1c1
Sequence:CCGGCGTGAAGATATTGGAGATAATCTCGAGATTATCTCCAATATCTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016343
VALIDATED
CENPF MISSION shRNA shRNA Plasmid DNA
centromere protein F, 350/400kDa
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000288967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016343.3-1579s21c1
Sequence:CCGGGCGAGTCAGATCAAGGAGAATCTCGAGATTCTCCTTGATCTGACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016343.3-5809s21c1
Sequence:CCGGCGTGAAGATATTGGAGATAATCTCGAGATTATCTCCAATATCTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288970    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016343.3-9724s21c1
Sequence:CCGGCCATTCCTCTACTGCAATGTACTCGAGTACATTGCAGTAGAGGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016343.3-3876s21c1
Sequence:CCGGGCAGCATGAATTACAGACAATCTCGAGATTGTCTGTAATTCATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016343.3-3092s21c1
Sequence:CCGGCCCAAGAGAATGGGACTCTTACTCGAGTAAGAGTCCCATTCTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062673    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016343.3-9724s1c1
Sequence:CCGGCCATTCCTCTACTGCAATGTACTCGAGTACATTGCAGTAGAGGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016343.3-3092s1c1
Sequence:CCGGCCCAAGAGAATGGGACTCTTACTCGAGTAAGAGTCCCATTCTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016343.3-3876s1c1
Sequence:CCGGGCAGCATGAATTACAGACAATCTCGAGATTGTCTGTAATTCATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016343.3-1579s1c1
Sequence:CCGGGCGAGTCAGATCAAGGAGAATCTCGAGATTCTCCTTGATCTGACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016343.3-5809s1c1
Sequence:CCGGCGTGAAGATATTGGAGATAATCTCGAGATTATCTCCAATATCTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016343
VALIDATED
CENPF MISSION shRNA Lentiviral Transduction Particles
centromere protein F, 350/400kDa
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000288967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016343.3-1579s21c1
Sequence:CCGGGCGAGTCAGATCAAGGAGAATCTCGAGATTCTCCTTGATCTGACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016343.3-5809s21c1
Sequence:CCGGCGTGAAGATATTGGAGATAATCTCGAGATTATCTCCAATATCTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288970    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016343.3-9724s21c1
Sequence:CCGGCCATTCCTCTACTGCAATGTACTCGAGTACATTGCAGTAGAGGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016343.3-3876s21c1
Sequence:CCGGGCAGCATGAATTACAGACAATCTCGAGATTGTCTGTAATTCATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016343.3-3092s21c1
Sequence:CCGGCCCAAGAGAATGGGACTCTTACTCGAGTAAGAGTCCCATTCTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062673    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016343.3-9724s1c1
Sequence:CCGGCCATTCCTCTACTGCAATGTACTCGAGTACATTGCAGTAGAGGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016343.3-3092s1c1
Sequence:CCGGCCCAAGAGAATGGGACTCTTACTCGAGTAAGAGTCCCATTCTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016343.3-3876s1c1
Sequence:CCGGGCAGCATGAATTACAGACAATCTCGAGATTGTCTGTAATTCATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016343.3-1579s1c1
Sequence:CCGGGCGAGTCAGATCAAGGAGAATCTCGAGATTCTCCTTGATCTGACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016343.3-5809s1c1
Sequence:CCGGCGTGAAGATATTGGAGATAATCTCGAGATTATCTCCAATATCTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081363
VALIDATED
CENPF MISSION shRNA Bacterial Glycerol Stock
centromere protein F, 350/400kDa
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000241996    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081363.2-9939s21c1
Sequence:CCGGGGTTTGAGAATATGGATATATCTCGAGATATATCCATATTCTCAAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081363.2-7457s21c1
Sequence:CCGGGATGCTTCAAACTCAATTAAACTCGAGTTTAATTGAGTTTGAAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081363.2-666s21c1
Sequence:CCGGAGGTTAGAGGAAGAGGTTAAACTCGAGTTTAACCTCTTCCTCTAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081363.2-8701s21c1
Sequence:CCGGACGAGCAGGAAACCGAGTTTGCTCGAGCAAACTCGGTTTCCTGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081363
VALIDATED
CENPF MISSION shRNA shRNA Plasmid DNA
centromere protein F, 350/400kDa
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000241996    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081363.2-9939s21c1
Sequence:CCGGGGTTTGAGAATATGGATATATCTCGAGATATATCCATATTCTCAAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081363.2-7457s21c1
Sequence:CCGGGATGCTTCAAACTCAATTAAACTCGAGTTTAATTGAGTTTGAAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081363.2-666s21c1
Sequence:CCGGAGGTTAGAGGAAGAGGTTAAACTCGAGTTTAACCTCTTCCTCTAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081363.2-8701s21c1
Sequence:CCGGACGAGCAGGAAACCGAGTTTGCTCGAGCAAACTCGGTTTCCTGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081363
VALIDATED
CENPF MISSION shRNA Lentiviral Transduction Particles
centromere protein F, 350/400kDa
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000241996    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081363.2-9939s21c1
Sequence:CCGGGGTTTGAGAATATGGATATATCTCGAGATATATCCATATTCTCAAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081363.2-7457s21c1
Sequence:CCGGGATGCTTCAAACTCAATTAAACTCGAGTTTAATTGAGTTTGAAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081363.2-666s21c1
Sequence:CCGGAGGTTAGAGGAAGAGGTTAAACTCGAGTTTAACCTCTTCCTCTAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081363.2-8701s21c1
Sequence:CCGGACGAGCAGGAAACCGAGTTTGCTCGAGCAAACTCGGTTTCCTGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks