EMAIL THIS PAGE TO A FRIEND

CENPH

centromere protein H

UniProtKB ID: Q9H3R5, A8K3Y1
Gene ID:
Human(64946) Summary: Centromere and kinetochore proteins play a critical role in centromere structure, kinetochore formation, and sister chromatid separation. The protein encoded by this gene colocalizes with inner kinetochore plate proteins CENP-A and CENP-C in both interphase and metaphase. It localizes outside of centromeric heterochromatin, where CENP-B is localized, and inside the kinetochore corona, where CENP-E is localized during prometaphase. It is thought that this protein can bind to itself, as well as to CENP-A, CENP-B or CENP-C. Multimers of the protein localize constitutively to the inner kinetochore plate and play an important role in the organization and function of the active centromere-kinetochore complex. [provided by RefSeq, Jul 2008]
Mouse(26886) centromere protein H
Rat(365658) centromere autoantigen H
Zebrafish(567359) centromere protein H
cow(505284) centromere protein H
domestic cat(101088300) centromere protein H
dog(610124) centromere protein H
chicken(395316) centromere protein H
sheep(101120440) centromere protein H
domestic guinea pig(101788801) centromere protein H
naked mole-rat(101701025) centromere protein H
38 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022909 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022909 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022909 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021886 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021886 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021886 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU040731 MISSION® esiRNA esiRNA human CENPH (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022909 Rosetta Predictions human pricing
NM_021886 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022909 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00189908 predicted 767
2 SASI_Hs01_00189909 predicted 764
3 SASI_Hs01_00189910 predicted 706
4 SASI_Hs01_00189911 predicted 631
5 SASI_Hs01_00189912 predicted 724
6 SASI_Hs01_00189913 predicted 626
7 SASI_Hs01_00189914 predicted 724
8 SASI_Hs01_00189915 predicted 651
9 SASI_Hs01_00189916 predicted 627
10 SASI_Hs01_00189917 predicted 631
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021886 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00142287 predicted 232
2 SASI_Mm02_00326448 predicted 385
3 SASI_Mm01_00142288 predicted 375
4 SASI_Mm01_00142289 predicted 424
5 SASI_Mm02_00326449 predicted 933
6 SASI_Mm01_00142290 predicted 909
7 SASI_Mm01_00142291 predicted 950
8 SASI_Mm01_00142292 predicted 274
9 SASI_Mm01_00142293 predicted 280
10 SASI_Mm01_00142295 predicted 400
11 SASI_Mm01_00142294 predicted 442
12 SASI_Mm01_00142296 predicted 396
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022909
VALIDATED
CENPH MISSION shRNA Bacterial Glycerol Stock
centromere protein H
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074138    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_022909.3-966s1c1
Sequence:CCGGGTTAGTTATTTGTAGTGGGATCTCGAGATCCCACTACAAATAACTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_022909.3-804s1c1
Sequence:CCGGGCTTGAGAAGAATGTTGACATCTCGAGATGTCAACATTCTTCTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_022909.3-292s1c1
Sequence:CCGGCCAGAACAAATTATGCAAGAACTCGAGTTCTTGCATAATTTGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_022909.3-633s1c1
Sequence:CCGGGAAGATTGATTTGGACAGTATCTCGAGATACTGTCCAAATCAATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A3
TRC Version: 1 Clone ID:NM_022909.3-405s1c1
Sequence:CCGGGAGACTTTCAACTGCACTTAACTCGAGTTAAGTGCAGTTGAAAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022909.3-668s21c1
Sequence:CCGGGGATAAAGATCATACGACAAACTCGAGTTTGTCGTATGATCTTTATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423741    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022909.3-901s21c1
Sequence:CCGGTTTGTCTGTCCACCGTAATTTCTCGAGAAATTACGGTGGACAGACAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412875    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022909.3-928s21c1
Sequence:CCGGAGCATATCCATAACGTTTACACTCGAGTGTAAACGTTATGGATATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022909.3-510s21c1
Sequence:CCGGGAAATCACAGCAGGAATCTTGCTCGAGCAAGATTCCTGCTGTGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431964    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022909.3-864s21c1
Sequence:CCGGTGGCAATCTCAACTCTTATTTCTCGAGAAATAAGAGTTGAGATTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022909
VALIDATED
CENPH MISSION shRNA shRNA Plasmid DNA
centromere protein H
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074138    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_022909.3-966s1c1
Sequence:CCGGGTTAGTTATTTGTAGTGGGATCTCGAGATCCCACTACAAATAACTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_022909.3-804s1c1
Sequence:CCGGGCTTGAGAAGAATGTTGACATCTCGAGATGTCAACATTCTTCTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_022909.3-292s1c1
Sequence:CCGGCCAGAACAAATTATGCAAGAACTCGAGTTCTTGCATAATTTGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_022909.3-633s1c1
Sequence:CCGGGAAGATTGATTTGGACAGTATCTCGAGATACTGTCCAAATCAATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A3
TRC Version: 1 Clone ID:NM_022909.3-405s1c1
Sequence:CCGGGAGACTTTCAACTGCACTTAACTCGAGTTAAGTGCAGTTGAAAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022909.3-668s21c1
Sequence:CCGGGGATAAAGATCATACGACAAACTCGAGTTTGTCGTATGATCTTTATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423741    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022909.3-901s21c1
Sequence:CCGGTTTGTCTGTCCACCGTAATTTCTCGAGAAATTACGGTGGACAGACAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412875    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022909.3-928s21c1
Sequence:CCGGAGCATATCCATAACGTTTACACTCGAGTGTAAACGTTATGGATATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022909.3-510s21c1
Sequence:CCGGGAAATCACAGCAGGAATCTTGCTCGAGCAAGATTCCTGCTGTGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431964    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022909.3-864s21c1
Sequence:CCGGTGGCAATCTCAACTCTTATTTCTCGAGAAATAAGAGTTGAGATTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022909
VALIDATED
CENPH MISSION shRNA Lentiviral Transduction Particles
centromere protein H
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074138    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_022909.3-966s1c1
Sequence:CCGGGTTAGTTATTTGTAGTGGGATCTCGAGATCCCACTACAAATAACTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_022909.3-804s1c1
Sequence:CCGGGCTTGAGAAGAATGTTGACATCTCGAGATGTCAACATTCTTCTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_022909.3-292s1c1
Sequence:CCGGCCAGAACAAATTATGCAAGAACTCGAGTTCTTGCATAATTTGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_022909.3-633s1c1
Sequence:CCGGGAAGATTGATTTGGACAGTATCTCGAGATACTGTCCAAATCAATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A3
TRC Version: 1 Clone ID:NM_022909.3-405s1c1
Sequence:CCGGGAGACTTTCAACTGCACTTAACTCGAGTTAAGTGCAGTTGAAAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022909.3-668s21c1
Sequence:CCGGGGATAAAGATCATACGACAAACTCGAGTTTGTCGTATGATCTTTATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423741    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022909.3-901s21c1
Sequence:CCGGTTTGTCTGTCCACCGTAATTTCTCGAGAAATTACGGTGGACAGACAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412875    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022909.3-928s21c1
Sequence:CCGGAGCATATCCATAACGTTTACACTCGAGTGTAAACGTTATGGATATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022909.3-510s21c1
Sequence:CCGGGAAATCACAGCAGGAATCTTGCTCGAGCAAGATTCCTGCTGTGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431964    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022909.3-864s21c1
Sequence:CCGGTGGCAATCTCAACTCTTATTTCTCGAGAAATAAGAGTTGAGATTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021886
VALIDATED
CENPH MISSION shRNA Bacterial Glycerol Stock
centromere protein H
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000072102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021886.1-415s1c1
Sequence:CCGGTCGGGATAACATGGAGAACATCTCGAGATGTTCTCCATGTTATCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021886.1-285s1c1
Sequence:CCGGCAGAACAGATTATGCAAGAAACTCGAGTTTCTTGCATAATCTGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021886.1-705s1c1
Sequence:CCGGCTACAGTTGTTCAACATACATCTCGAGATGTATGTTGAACAACTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021886.1-538s1c1
Sequence:CCGGGCTGCTTGATGTCAGAAAGAACTCGAGTTCTTTCTGACATCAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021886.1-238s1c1
Sequence:CCGGGCTCTTAGAATATAAGTCCATCTCGAGATGGACTTATATTCTAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021886.1-285s21c3
Sequence:CCGGCAGAACAGATTATGCAAGAAACTCGAGTTTCTTGCATAATCTGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021886.1-538s21c1
Sequence:CCGGGCTGCTTGATGTCAGAAAGAACTCGAGTTCTTTCTGACATCAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021886.1-238s21c3
Sequence:CCGGGCTCTTAGAATATAAGTCCATCTCGAGATGGACTTATATTCTAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021886.1-415s21c3
Sequence:CCGGTCGGGATAACATGGAGAACATCTCGAGATGTTCTCCATGTTATCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021886.1-705s21c2
Sequence:CCGGCTACAGTTGTTCAACATACATCTCGAGATGTATGTTGAACAACTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021886
VALIDATED
CENPH MISSION shRNA shRNA Plasmid DNA
centromere protein H
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000072102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021886.1-415s1c1
Sequence:CCGGTCGGGATAACATGGAGAACATCTCGAGATGTTCTCCATGTTATCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021886.1-285s1c1
Sequence:CCGGCAGAACAGATTATGCAAGAAACTCGAGTTTCTTGCATAATCTGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021886.1-705s1c1
Sequence:CCGGCTACAGTTGTTCAACATACATCTCGAGATGTATGTTGAACAACTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021886.1-538s1c1
Sequence:CCGGGCTGCTTGATGTCAGAAAGAACTCGAGTTCTTTCTGACATCAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021886.1-238s1c1
Sequence:CCGGGCTCTTAGAATATAAGTCCATCTCGAGATGGACTTATATTCTAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021886.1-285s21c3
Sequence:CCGGCAGAACAGATTATGCAAGAAACTCGAGTTTCTTGCATAATCTGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021886.1-538s21c1
Sequence:CCGGGCTGCTTGATGTCAGAAAGAACTCGAGTTCTTTCTGACATCAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021886.1-238s21c3
Sequence:CCGGGCTCTTAGAATATAAGTCCATCTCGAGATGGACTTATATTCTAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021886.1-415s21c3
Sequence:CCGGTCGGGATAACATGGAGAACATCTCGAGATGTTCTCCATGTTATCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021886.1-705s21c2
Sequence:CCGGCTACAGTTGTTCAACATACATCTCGAGATGTATGTTGAACAACTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021886
VALIDATED
CENPH MISSION shRNA Lentiviral Transduction Particles
centromere protein H
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000072102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021886.1-415s1c1
Sequence:CCGGTCGGGATAACATGGAGAACATCTCGAGATGTTCTCCATGTTATCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021886.1-285s1c1
Sequence:CCGGCAGAACAGATTATGCAAGAAACTCGAGTTTCTTGCATAATCTGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021886.1-705s1c1
Sequence:CCGGCTACAGTTGTTCAACATACATCTCGAGATGTATGTTGAACAACTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021886.1-538s1c1
Sequence:CCGGGCTGCTTGATGTCAGAAAGAACTCGAGTTCTTTCTGACATCAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021886.1-238s1c1
Sequence:CCGGGCTCTTAGAATATAAGTCCATCTCGAGATGGACTTATATTCTAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021886.1-285s21c3
Sequence:CCGGCAGAACAGATTATGCAAGAAACTCGAGTTTCTTGCATAATCTGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021886.1-538s21c1
Sequence:CCGGGCTGCTTGATGTCAGAAAGAACTCGAGTTCTTTCTGACATCAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021886.1-238s21c3
Sequence:CCGGGCTCTTAGAATATAAGTCCATCTCGAGATGGACTTATATTCTAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021886.1-415s21c3
Sequence:CCGGTCGGGATAACATGGAGAACATCTCGAGATGTTCTCCATGTTATCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021886.1-705s21c2
Sequence:CCGGCTACAGTTGTTCAACATACATCTCGAGATGTATGTTGAACAACTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks