EMAIL THIS PAGE TO A FRIEND

CENPI

centromere protein I

50 Gene Product Result for
Synonyms: CENP-I FSHPRH1 LRPR1 Mis6
UniProtKB ID: Q92674, Q5JWZ9, Q96ED0
Gene ID:
Human(2491) Summary: The product of this gene is involved in the response of gonadal tissues to follicle-stimulating hormone. This gene is also a potential candidate for human X-linked disorders of gonadal development and gametogenesis. [provided by RefSeq, Jul 2008]
Mouse(102920) centromere protein I
Rat(25448) centromere protein I
naked mole-rat(101717327) centromere protein I
domestic guinea pig(100719513) centromere protein I
sheep(101104558) centromere protein I
Zebrafish(558570) centromere protein I
cow(512877) centromere protein I
Horse(100057508) centromere protein I
chicken(395207) centromere protein I
dog(492018) centromere protein I
domestic cat(101086881) centromere protein I
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006733 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006733 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006733 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145924 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145924 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145924 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006733 Rosetta Predictions human pricing
NM_012955 Rosetta Predictions rat pricing
NM_145924 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006733 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00013961 predicted 2181
2 SASI_Hs01_00013962 predicted 907
3 SASI_Hs01_00013963 predicted 1854
4 SASI_Hs01_00013964 predicted 1139
5 SASI_Hs01_00013965 predicted 802
6 SASI_Hs02_00342177 predicted 1991
7 SASI_Hs01_00013968 predicted 718
8 SASI_Hs02_00342178 predicted 1004
9 SASI_Hs01_00013969 predicted 1804
10 SASI_Hs02_00342179 predicted 1188
11 SASI_Hs01_00013960 predicted 1753
12 SASI_Hs01_00013966 predicted 470
13 SASI_Hs01_00013967 predicted 1818
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012955 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00045482 predicted 2200
2 SASI_Rn01_00045484 predicted 418
3 SASI_Rn01_00045485 predicted 831
4 SASI_Rn01_00045486 predicted 1098
5 SASI_Rn01_00045487 predicted 556
6 SASI_Rn01_00045488 predicted 368
7 SASI_Rn01_00045489 predicted 2145
8 SASI_Rn01_00045490 predicted 1335
9 SASI_Rn01_00045491 predicted 2246
10 SASI_Rn02_00260543 predicted 1320
11 SASI_Rn01_00045483 predicted 547
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145924 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00076202 predicted 633
2 SASI_Mm01_00076203 predicted 1192
3 SASI_Mm01_00076204 predicted 2065
4 SASI_Mm02_00341379 predicted 2211
5 SASI_Mm01_00076205 predicted 482
6 SASI_Mm01_00076206 predicted 629
7 SASI_Mm01_00076207 predicted 1185
8 SASI_Mm01_00076209 predicted 2185
9 SASI_Mm01_00076210 predicted 1414
10 SASI_Mm01_00076211 predicted 1252
11 SASI_Mm01_00076208 predicted 1165
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006733
VALIDATED
CENPI MISSION shRNA Bacterial Glycerol Stock
centromere protein I
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006733.2-413s21c1
Sequence:CCGGACAATCCAGTGGGAGATTATGCTCGAGCATAATCTCCCACTGGATTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006733.2-2419s21c1
Sequence:CCGGAGCTGGTATTTGGACTATTTACTCGAGTAAATAGTCCAAATACCAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006733.2-2330s1c1
Sequence:CCGGCTTTCTTGAGTTACGCTGTTTCTCGAGAAACAGCGTAACTCAAGAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006733.2-499s1c1
Sequence:CCGGCCCATTAAAGCTTCACAGAATCTCGAGATTCTGTGAAGCTTTAATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_006733.2-1010s1c1
Sequence:CCGGCTGCTCTGATTTCAGTATCTTCTCGAGAAGATACTGAAATCAGAGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_006733.2-1710s1c1
Sequence:CCGGGCTCTTCTTTACATCAACCATCTCGAGATGGTTGATGTAAAGAAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_006733.2-1759s1c1
Sequence:CCGGCTGAAAGAGCTATTGCAGAATCTCGAGATTCTGCAATAGCTCTTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006733
VALIDATED
CENPI MISSION shRNA shRNA Plasmid DNA
centromere protein I
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006733.2-413s21c1
Sequence:CCGGACAATCCAGTGGGAGATTATGCTCGAGCATAATCTCCCACTGGATTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006733.2-2419s21c1
Sequence:CCGGAGCTGGTATTTGGACTATTTACTCGAGTAAATAGTCCAAATACCAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006733.2-2330s1c1
Sequence:CCGGCTTTCTTGAGTTACGCTGTTTCTCGAGAAACAGCGTAACTCAAGAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006733.2-499s1c1
Sequence:CCGGCCCATTAAAGCTTCACAGAATCTCGAGATTCTGTGAAGCTTTAATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_006733.2-1010s1c1
Sequence:CCGGCTGCTCTGATTTCAGTATCTTCTCGAGAAGATACTGAAATCAGAGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_006733.2-1710s1c1
Sequence:CCGGGCTCTTCTTTACATCAACCATCTCGAGATGGTTGATGTAAAGAAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_006733.2-1759s1c1
Sequence:CCGGCTGAAAGAGCTATTGCAGAATCTCGAGATTCTGCAATAGCTCTTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006733
VALIDATED
CENPI MISSION shRNA Lentiviral Transduction Particles
centromere protein I
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006733.2-413s21c1
Sequence:CCGGACAATCCAGTGGGAGATTATGCTCGAGCATAATCTCCCACTGGATTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006733.2-2419s21c1
Sequence:CCGGAGCTGGTATTTGGACTATTTACTCGAGTAAATAGTCCAAATACCAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006733.2-2330s1c1
Sequence:CCGGCTTTCTTGAGTTACGCTGTTTCTCGAGAAACAGCGTAACTCAAGAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006733.2-499s1c1
Sequence:CCGGCCCATTAAAGCTTCACAGAATCTCGAGATTCTGTGAAGCTTTAATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_006733.2-1010s1c1
Sequence:CCGGCTGCTCTGATTTCAGTATCTTCTCGAGAAGATACTGAAATCAGAGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_006733.2-1710s1c1
Sequence:CCGGGCTCTTCTTTACATCAACCATCTCGAGATGGTTGATGTAAAGAAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_006733.2-1759s1c1
Sequence:CCGGCTGAAAGAGCTATTGCAGAATCTCGAGATTCTGCAATAGCTCTTTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145924
VALIDATED
CENPI MISSION shRNA Bacterial Glycerol Stock
centromere protein I
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000247506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145924.2-720s21c1
Sequence:CCGGTGACAAGTGTTCTGGTAATACCTCGAGGTATTACCAGAACACTTGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145924.2-1423s21c1
Sequence:CCGGTATTGGTTGAGTCAAGCATTACTCGAGTAATGCTTGACTCAACCAATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145924.2-630s21c1
Sequence:CCGGTGCTGTAAACTCACGGATATTCTCGAGAATATCCGTGAGTTTACAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247510    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145924.2-2839s21c1
Sequence:CCGGTTACTCCTCAGACATACTTATCTCGAGATAAGTATGTCTGAGGAGTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145924.2-2074s21c1
Sequence:CCGGATGTACAGGTATCGCAATAATCTCGAGATTATTGCGATACCTGTACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175736    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145924.1-463s1c1
Sequence:CCGGGCAGTAGGATACTTCCAGAAACTCGAGTTTCTGGAAGTATCCTACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174853    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145924.1-2391s1c1
Sequence:CCGGGAAGAAATGGAACTGGTATTTCTCGAGAAATACCAGTTCCATTTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175464    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145924.1-1838s1c1
Sequence:CCGGCCATGAGTTCTGTGTCTCAATCTCGAGATTGAGACACAGAACTCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145924
VALIDATED
CENPI MISSION shRNA shRNA Plasmid DNA
centromere protein I
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000247506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145924.2-720s21c1
Sequence:CCGGTGACAAGTGTTCTGGTAATACCTCGAGGTATTACCAGAACACTTGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145924.2-1423s21c1
Sequence:CCGGTATTGGTTGAGTCAAGCATTACTCGAGTAATGCTTGACTCAACCAATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145924.2-630s21c1
Sequence:CCGGTGCTGTAAACTCACGGATATTCTCGAGAATATCCGTGAGTTTACAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247510    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145924.2-2839s21c1
Sequence:CCGGTTACTCCTCAGACATACTTATCTCGAGATAAGTATGTCTGAGGAGTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145924.2-2074s21c1
Sequence:CCGGATGTACAGGTATCGCAATAATCTCGAGATTATTGCGATACCTGTACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175736    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145924.1-463s1c1
Sequence:CCGGGCAGTAGGATACTTCCAGAAACTCGAGTTTCTGGAAGTATCCTACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174853    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145924.1-2391s1c1
Sequence:CCGGGAAGAAATGGAACTGGTATTTCTCGAGAAATACCAGTTCCATTTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175464    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145924.1-1838s1c1
Sequence:CCGGCCATGAGTTCTGTGTCTCAATCTCGAGATTGAGACACAGAACTCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145924
VALIDATED
CENPI MISSION shRNA Lentiviral Transduction Particles
centromere protein I
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000247506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145924.2-720s21c1
Sequence:CCGGTGACAAGTGTTCTGGTAATACCTCGAGGTATTACCAGAACACTTGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145924.2-1423s21c1
Sequence:CCGGTATTGGTTGAGTCAAGCATTACTCGAGTAATGCTTGACTCAACCAATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145924.2-630s21c1
Sequence:CCGGTGCTGTAAACTCACGGATATTCTCGAGAATATCCGTGAGTTTACAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247510    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145924.2-2839s21c1
Sequence:CCGGTTACTCCTCAGACATACTTATCTCGAGATAAGTATGTCTGAGGAGTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145924.2-2074s21c1
Sequence:CCGGATGTACAGGTATCGCAATAATCTCGAGATTATTGCGATACCTGTACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175736    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145924.1-463s1c1
Sequence:CCGGGCAGTAGGATACTTCCAGAAACTCGAGTTTCTGGAAGTATCCTACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174853    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145924.1-2391s1c1
Sequence:CCGGGAAGAAATGGAACTGGTATTTCTCGAGAAATACCAGTTCCATTTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175464    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145924.1-1838s1c1
Sequence:CCGGCCATGAGTTCTGTGTCTCAATCTCGAGATTGAGACACAGAACTCATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)