EMAIL THIS PAGE TO A FRIEND

CENPJ

centromere protein J

53 Gene Product Result for
Synonyms: BM032 CENP-J CPAP LAP LIP1 MCPH6 SASS4 SCKL4 Sas-4
UniProtKB ID: Q9HC77, Q2KHM6, Q5T6R5, Q96KS5, Q9C067
Gene ID:
Human(55835) Summary: This gene encodes a protein that belongs to the centromere protein family. During cell division, this protein plays a structural role in the maintenance of centrosome integrity and normal spindle morphology, and it is involved in microtubule disassembly at the centrosome. This protein can function as a transcriptional coactivator in the Stat5 signaling pathway, and also as a coactivator of NF-kappaB-mediated transcription, likely via its interaction with the coactivator p300/CREB-binding protein. Mutations in this gene are associated with primary autosomal recessive microcephaly, a disorder characterized by severely reduced brain size and mental retardation. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Apr 2012]
Mouse(219103) centromere protein J
Rat(305909) centromere protein J
Zebrafish(568957) centromere protein J
chicken(418960) centromere protein J
dog(486055) centromere protein J
domestic cat(101081107) centromere protein J
Horse(100049819) centromere protein J
cow(613543) centromere protein J
sheep(101119996) centromere protein J
domestic guinea pig(100712775) centromere protein J
naked mole-rat(101715831) centromere protein J
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018451 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018451 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018451 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001014996 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001014996 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001014996 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018451 Rosetta Predictions human pricing
NM_001107265 Rosetta Predictions rat pricing
NM_001014996 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018451 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00069692 predicted 3258
2 SASI_Hs01_00069693 predicted 1793
3 SASI_Hs02_00351991 predicted 2715
4 SASI_Hs01_00069694 predicted 3116
5 SASI_Hs01_00069695 predicted 2727
6 SASI_Hs01_00069696 predicted 1575
7 SASI_Hs02_00351992 predicted 532
8 SASI_Hs02_00351993 predicted 1258
9 SASI_Hs01_00069698 predicted 1683
10 SASI_Hs01_00069699 predicted 4055
11 SASI_Hs01_00069697 predicted 3286
12 SASI_Hs01_00069700 predicted 473
13 SASI_Hs01_00069701 predicted 683
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107265 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00227135 predicted 3643
2 SASI_Rn02_00227136 predicted 2386
3 SASI_Rn02_00227137 predicted 3246
4 SASI_Rn02_00227138 predicted 2884
5 SASI_Rn02_00227139 predicted 1400
6 SASI_Rn02_00227140 predicted 2540
7 SASI_Rn02_00227141 predicted 2588
8 SASI_Rn02_00227142 predicted 2878
9 SASI_Rn02_00227143 predicted 3872
10 SASI_Rn02_00227144 predicted 2138
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014996 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00020216 predicted 3771
2 SASI_Mm01_00020217 predicted 3230
3 SASI_Mm01_00020218 predicted 1560
4 SASI_Mm01_00020219 predicted 2401
5 SASI_Mm01_00020220 predicted 1656
6 SASI_Mm01_00020221 predicted 1589
7 SASI_Mm02_00287452 predicted 3384
8 SASI_Mm01_00020222 predicted 2647
9 SASI_Mm01_00020224 predicted 2247
10 SASI_Mm01_00020225 predicted 3006
11 SASI_Mm01_00020223 predicted 2023
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018451
VALIDATED
CENPJ MISSION shRNA Bacterial Glycerol Stock
centromere protein J
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000072603    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018451.2-4232s1c1
Sequence:CCGGCCTCATGTGATCATGAAGTAACTCGAGTTACTTCATGATCACATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_018451.2-3714s1c1
Sequence:CCGGCCGTGTTATACTGTTTCCCAACTCGAGTTGGGAAACAGTATAACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_018451.2-1357s1c1
Sequence:CCGGGCTAGATTTACTAATGCCAAACTCGAGTTTGGCATTAGTAAATCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_018451.2-2403s1c1
Sequence:CCGGCCCACAAGTCTGTGATGATAACTCGAGTTATCATCACAGACTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018451.2-3715s1c1
Sequence:CCGGCGTGTTATACTGTTTCCCAATCTCGAGATTGGGAAACAGTATAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433857    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018451.3-4545s21c1
Sequence:CCGGATTGGTTAGAAATGGCTATAACTCGAGTTATAGCCATTTCTAACCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018451.3-1198s21c1
Sequence:CCGGTTCCTCAGAAGTGGCTAATATCTCGAGATATTAGCCACTTCTGAGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424633    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018451.3-4647s21c1
Sequence:CCGGAGGTGTACTCAAGGAGTAAACCTCGAGGTTTACTCCTTGAGTACACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018451.3-3122s21c1
Sequence:CCGGGCTCGAATAGAAGAGTTTAAACTCGAGTTTAAACTCTTCTATTCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018451
VALIDATED
CENPJ MISSION shRNA shRNA Plasmid DNA
centromere protein J
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000072603    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018451.2-4232s1c1
Sequence:CCGGCCTCATGTGATCATGAAGTAACTCGAGTTACTTCATGATCACATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_018451.2-3714s1c1
Sequence:CCGGCCGTGTTATACTGTTTCCCAACTCGAGTTGGGAAACAGTATAACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_018451.2-1357s1c1
Sequence:CCGGGCTAGATTTACTAATGCCAAACTCGAGTTTGGCATTAGTAAATCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_018451.2-2403s1c1
Sequence:CCGGCCCACAAGTCTGTGATGATAACTCGAGTTATCATCACAGACTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018451.2-3715s1c1
Sequence:CCGGCGTGTTATACTGTTTCCCAATCTCGAGATTGGGAAACAGTATAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433857    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018451.3-4545s21c1
Sequence:CCGGATTGGTTAGAAATGGCTATAACTCGAGTTATAGCCATTTCTAACCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018451.3-1198s21c1
Sequence:CCGGTTCCTCAGAAGTGGCTAATATCTCGAGATATTAGCCACTTCTGAGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424633    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018451.3-4647s21c1
Sequence:CCGGAGGTGTACTCAAGGAGTAAACCTCGAGGTTTACTCCTTGAGTACACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018451.3-3122s21c1
Sequence:CCGGGCTCGAATAGAAGAGTTTAAACTCGAGTTTAAACTCTTCTATTCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018451
VALIDATED
CENPJ MISSION shRNA Lentiviral Transduction Particles
centromere protein J
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000072603    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018451.2-4232s1c1
Sequence:CCGGCCTCATGTGATCATGAAGTAACTCGAGTTACTTCATGATCACATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_018451.2-3714s1c1
Sequence:CCGGCCGTGTTATACTGTTTCCCAACTCGAGTTGGGAAACAGTATAACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_018451.2-1357s1c1
Sequence:CCGGGCTAGATTTACTAATGCCAAACTCGAGTTTGGCATTAGTAAATCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_018451.2-2403s1c1
Sequence:CCGGCCCACAAGTCTGTGATGATAACTCGAGTTATCATCACAGACTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018451.2-3715s1c1
Sequence:CCGGCGTGTTATACTGTTTCCCAATCTCGAGATTGGGAAACAGTATAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433857    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018451.3-4545s21c1
Sequence:CCGGATTGGTTAGAAATGGCTATAACTCGAGTTATAGCCATTTCTAACCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018451.3-1198s21c1
Sequence:CCGGTTCCTCAGAAGTGGCTAATATCTCGAGATATTAGCCACTTCTGAGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424633    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018451.3-4647s21c1
Sequence:CCGGAGGTGTACTCAAGGAGTAAACCTCGAGGTTTACTCCTTGAGTACACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018451.3-3122s21c1
Sequence:CCGGGCTCGAATAGAAGAGTTTAAACTCGAGTTTAAACTCTTCTATTCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001014996
CENPJ MISSION shRNA Bacterial Glycerol Stock
centromere protein J
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000072121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014996.1-1870s1c1
Sequence:CCGGGCTGCTGATGAAATATCATTTCTCGAGAAATGATATTTCATCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014996.1-863s1c1
Sequence:CCGGCCACTCAAGATTCCGTATTAACTCGAGTTAATACGGAATCTTGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072118    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001014996.1-4201s1c1
Sequence:CCGGGTGGGATTAATCATGAAGTAACTCGAGTTACTTCATGATTAATCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014996.1-3921s1c1
Sequence:CCGGCCAGACCATTAAGACTTTATTCTCGAGAATAAAGTCTTAATGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014996.1-715s1c1
Sequence:CCGGCCAGGTACATTACTGCCTGATCTCGAGATCAGGCAGTAATGTACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001014996
CENPJ MISSION shRNA shRNA Plasmid DNA
centromere protein J
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000072121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014996.1-1870s1c1
Sequence:CCGGGCTGCTGATGAAATATCATTTCTCGAGAAATGATATTTCATCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014996.1-863s1c1
Sequence:CCGGCCACTCAAGATTCCGTATTAACTCGAGTTAATACGGAATCTTGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072118    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001014996.1-4201s1c1
Sequence:CCGGGTGGGATTAATCATGAAGTAACTCGAGTTACTTCATGATTAATCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014996.1-3921s1c1
Sequence:CCGGCCAGACCATTAAGACTTTATTCTCGAGAATAAAGTCTTAATGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014996.1-715s1c1
Sequence:CCGGCCAGGTACATTACTGCCTGATCTCGAGATCAGGCAGTAATGTACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001014996
CENPJ MISSION shRNA Lentiviral Transduction Particles
centromere protein J
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000072121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014996.1-1870s1c1
Sequence:CCGGGCTGCTGATGAAATATCATTTCTCGAGAAATGATATTTCATCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014996.1-863s1c1
Sequence:CCGGCCACTCAAGATTCCGTATTAACTCGAGTTAATACGGAATCTTGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072118    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001014996.1-4201s1c1
Sequence:CCGGGTGGGATTAATCATGAAGTAACTCGAGTTACTTCATGATTAATCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014996.1-3921s1c1
Sequence:CCGGCCAGACCATTAAGACTTTATTCTCGAGAATAAAGTCTTAATGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014996.1-715s1c1
Sequence:CCGGCCAGGTACATTACTGCCTGATCTCGAGATCAGGCAGTAATGTACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks