EMAIL THIS PAGE TO A FRIEND

CENPK

centromere protein K

61 Gene Product Result for
Synonyms: AF5alpha CENP-K P33 Solt
UniProtKB ID: Q9BS16, Q9H4L0
Gene ID:
Human(64105) Summary: CENPK is a subunit of a CENPH (MIM 605607)-CENPI (MIM 300065)-associated centromeric complex that targets CENPA (MIM 117139) to centromeres and is required for proper kinetochore function and mitotic progression (Okada et al., 2006 [PubMed 16622420]
Mouse(60411) centromere protein K
Rat(294712) centromere protein K
naked mole-rat(101715178) centromere protein K
domestic guinea pig(100728281) centromere protein K
sheep(101103592) centromere protein K
Zebrafish(565144) centromere protein K
chicken(427162) centromere protein K
dog(609707) centromere protein K
cow(506404) centromere protein K
domestic cat(101084850) centromere protein K
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022145 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022145 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022145 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021790 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021790 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021790 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU051491 MISSION® esiRNA esiRNA human CENPK (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022145 Rosetta Predictions human pricing
NM_001106407 Rosetta Predictions rat pricing
NM_021790 Rosetta Predictions mouse pricing
NM_181061 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022145 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00183450 predicted 374
2 SASI_Hs01_00183451 predicted 540
3 SASI_Hs01_00183452 predicted 351
4 SASI_Hs01_00183453 predicted 249
5 SASI_Hs01_00183454 predicted 362
6 SASI_Hs01_00183455 predicted 455
7 SASI_Hs01_00183456 predicted 221
8 SASI_Hs01_00183457 predicted 468
9 SASI_Hs01_00183459 predicted 507
10 SASI_Hs02_00355559 predicted 445
11 SASI_Hs01_00183458 predicted 492
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106407 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218658 predicted 710
2 SASI_Rn02_00218659 predicted 525
3 SASI_Rn02_00218660 predicted 833
4 SASI_Rn02_00218661 predicted 811
5 SASI_Rn02_00218662 predicted 1100
6 SASI_Rn02_00218663 predicted 1200
7 SASI_Rn02_00218664 predicted 892
8 SASI_Rn02_00218665 predicted 1212
9 SASI_Rn02_00218666 predicted 608
10 SASI_Rn02_00218667 predicted 526
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021790 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00076452 predicted 470
2 SASI_Mm01_00076453 predicted 717
3 SASI_Mm01_00076454 predicted 633
4 SASI_Mm01_00076455 predicted 704
5 SASI_Mm01_00076456 predicted 681
6 SASI_Mm01_00076457 predicted 717
7 SASI_Mm01_00076458 predicted 618
8 SASI_Mm01_00076459 predicted 723
9 SASI_Mm01_00076460 predicted 499
10 SASI_Mm02_00326431 predicted 621
11 SASI_Mm01_00076451 predicted 643
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181061 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00161841 predicted 255
2 SASI_Mm01_00161842 predicted 494
3 SASI_Mm01_00161843 predicted 409
4 SASI_Mm01_00161844 predicted 483
5 SASI_Mm01_00161845 predicted 459
6 SASI_Mm01_00161846 predicted 496
7 SASI_Mm01_00161847 predicted 396
8 SASI_Mm01_00161848 predicted 505
9 SASI_Mm01_00161849 predicted 270
10 SASI_Mm02_00349620 predicted 404
11 SASI_Mm01_00161840 predicted 415
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022145
VALIDATED
CENPK MISSION shRNA Bacterial Glycerol Stock
centromere protein K
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022145.3-742s21c1
Sequence:CCGGTGAGTACCTTGGGCGAGTTTCCTCGAGGAAACTCGCCCAAGGTACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022145.3-354s21c1
Sequence:CCGGGAAACACTCACCGATTCAAATCTCGAGATTTGAATCGGTGAGTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425338    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022145.3-1234s21c1
Sequence:CCGGTAAGAATGCAGGTAGATAATACTCGAGTATTATCTACCTGCATTCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417826    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022145.3-1460s21c1
Sequence:CCGGATATCTGAGGTGGCATAATTTCTCGAGAAATTATGCCACCTCAGATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022145.3-885s21c1
Sequence:CCGGGATGTTCCACATGATCCATATCTCGAGATATGGATCATGTGGAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167711    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_022145.2-1205s1c1
Sequence:CCGGGCTGCCATCTATTATTCATTTCTCGAGAAATGAATAATAGATGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_022145.2-352s1c1
Sequence:CCGGGAAATGTGGAAAGATATGGAACTCGAGTTCCATATCTTTCCACATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_022145.2-520s1c1
Sequence:CCGGGAAGACGTTCTCATAACATTACTCGAGTAATGTTATGAGAACGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167208    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022145.2-1044s1c1
Sequence:CCGGCCGAATAAGATTAGAAGCTTTCTCGAGAAAGCTTCTAATCTTATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167551    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_022145.2-1322s1c1
Sequence:CCGGGTACCTTACCTCATGCAATATCTCGAGATATTGCATGAGGTAAGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022145
VALIDATED
CENPK MISSION shRNA shRNA Plasmid DNA
centromere protein K
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022145.3-742s21c1
Sequence:CCGGTGAGTACCTTGGGCGAGTTTCCTCGAGGAAACTCGCCCAAGGTACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022145.3-354s21c1
Sequence:CCGGGAAACACTCACCGATTCAAATCTCGAGATTTGAATCGGTGAGTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425338    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022145.3-1234s21c1
Sequence:CCGGTAAGAATGCAGGTAGATAATACTCGAGTATTATCTACCTGCATTCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417826    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022145.3-1460s21c1
Sequence:CCGGATATCTGAGGTGGCATAATTTCTCGAGAAATTATGCCACCTCAGATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022145.3-885s21c1
Sequence:CCGGGATGTTCCACATGATCCATATCTCGAGATATGGATCATGTGGAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167711    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_022145.2-1205s1c1
Sequence:CCGGGCTGCCATCTATTATTCATTTCTCGAGAAATGAATAATAGATGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_022145.2-352s1c1
Sequence:CCGGGAAATGTGGAAAGATATGGAACTCGAGTTCCATATCTTTCCACATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_022145.2-520s1c1
Sequence:CCGGGAAGACGTTCTCATAACATTACTCGAGTAATGTTATGAGAACGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167208    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022145.2-1044s1c1
Sequence:CCGGCCGAATAAGATTAGAAGCTTTCTCGAGAAAGCTTCTAATCTTATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167551    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_022145.2-1322s1c1
Sequence:CCGGGTACCTTACCTCATGCAATATCTCGAGATATTGCATGAGGTAAGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022145
VALIDATED
CENPK MISSION shRNA Lentiviral Transduction Particles
centromere protein K
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022145.3-742s21c1
Sequence:CCGGTGAGTACCTTGGGCGAGTTTCCTCGAGGAAACTCGCCCAAGGTACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022145.3-354s21c1
Sequence:CCGGGAAACACTCACCGATTCAAATCTCGAGATTTGAATCGGTGAGTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425338    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022145.3-1234s21c1
Sequence:CCGGTAAGAATGCAGGTAGATAATACTCGAGTATTATCTACCTGCATTCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417826    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022145.3-1460s21c1
Sequence:CCGGATATCTGAGGTGGCATAATTTCTCGAGAAATTATGCCACCTCAGATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022145.3-885s21c1
Sequence:CCGGGATGTTCCACATGATCCATATCTCGAGATATGGATCATGTGGAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167711    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_022145.2-1205s1c1
Sequence:CCGGGCTGCCATCTATTATTCATTTCTCGAGAAATGAATAATAGATGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_022145.2-352s1c1
Sequence:CCGGGAAATGTGGAAAGATATGGAACTCGAGTTCCATATCTTTCCACATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_022145.2-520s1c1
Sequence:CCGGGAAGACGTTCTCATAACATTACTCGAGTAATGTTATGAGAACGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167208    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022145.2-1044s1c1
Sequence:CCGGCCGAATAAGATTAGAAGCTTTCTCGAGAAAGCTTCTAATCTTATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167551    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_022145.2-1322s1c1
Sequence:CCGGGTACCTTACCTCATGCAATATCTCGAGATATTGCATGAGGTAAGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021790
VALIDATED
CENPK MISSION shRNA Bacterial Glycerol Stock
centromere protein K
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021790.1-799s21c1
Sequence:CCGGACTAAGATCCGTGGGATAAAGCTCGAGCTTTATCCCACGGATCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021790.1-324s21c1
Sequence:CCGGAGTACATCCAGATACTATTACCTCGAGGTAATAGTATCTGGATGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021790.1-245s21c1
Sequence:CCGGCCACTTCTCCGTTGGTAATTTCTCGAGAAATTACCAACGGAGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021790.1-1043s21c1
Sequence:CCGGTACTTCTGCGTTACGGAATTGCTCGAGCAATTCCGTAACGCAGAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021790.1-716s21c1
Sequence:CCGGTGGACACTCTTAACGTATTAACTCGAGTTAATACGTTAAGAGTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021790.1-355s1c1
Sequence:CCGGGCTGTTATAGATACAGAGGAACTCGAGTTCCTCTGTATCTATAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021790.1-879s1c1
Sequence:CCGGGCCTGAAGCAAGTACTCCAAACTCGAGTTTGGAGTACTTGCTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021790.1-411s1c1
Sequence:CCGGCATGGAAGATTGTCAGAATAACTCGAGTTATTCTGACAATCTTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021790.1-614s1c1
Sequence:CCGGGTGATCTTGAAATGGTACTATCTCGAGATAGTACCATTTCAAGATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021790.1-1063s1c1
Sequence:CCGGGCTTTGAGACATCCAGAAGATCTCGAGATCTTCTGGATGTCTCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021790
VALIDATED
CENPK MISSION shRNA shRNA Plasmid DNA
centromere protein K
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021790.1-799s21c1
Sequence:CCGGACTAAGATCCGTGGGATAAAGCTCGAGCTTTATCCCACGGATCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021790.1-324s21c1
Sequence:CCGGAGTACATCCAGATACTATTACCTCGAGGTAATAGTATCTGGATGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021790.1-245s21c1
Sequence:CCGGCCACTTCTCCGTTGGTAATTTCTCGAGAAATTACCAACGGAGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021790.1-1043s21c1
Sequence:CCGGTACTTCTGCGTTACGGAATTGCTCGAGCAATTCCGTAACGCAGAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021790.1-716s21c1
Sequence:CCGGTGGACACTCTTAACGTATTAACTCGAGTTAATACGTTAAGAGTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021790.1-355s1c1
Sequence:CCGGGCTGTTATAGATACAGAGGAACTCGAGTTCCTCTGTATCTATAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021790.1-879s1c1
Sequence:CCGGGCCTGAAGCAAGTACTCCAAACTCGAGTTTGGAGTACTTGCTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021790.1-411s1c1
Sequence:CCGGCATGGAAGATTGTCAGAATAACTCGAGTTATTCTGACAATCTTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021790.1-614s1c1
Sequence:CCGGGTGATCTTGAAATGGTACTATCTCGAGATAGTACCATTTCAAGATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021790.1-1063s1c1
Sequence:CCGGGCTTTGAGACATCCAGAAGATCTCGAGATCTTCTGGATGTCTCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021790
VALIDATED
CENPK MISSION shRNA Lentiviral Transduction Particles
centromere protein K
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021790.1-799s21c1
Sequence:CCGGACTAAGATCCGTGGGATAAAGCTCGAGCTTTATCCCACGGATCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021790.1-324s21c1
Sequence:CCGGAGTACATCCAGATACTATTACCTCGAGGTAATAGTATCTGGATGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021790.1-245s21c1
Sequence:CCGGCCACTTCTCCGTTGGTAATTTCTCGAGAAATTACCAACGGAGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021790.1-1043s21c1
Sequence:CCGGTACTTCTGCGTTACGGAATTGCTCGAGCAATTCCGTAACGCAGAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021790.1-716s21c1
Sequence:CCGGTGGACACTCTTAACGTATTAACTCGAGTTAATACGTTAAGAGTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021790.1-355s1c1
Sequence:CCGGGCTGTTATAGATACAGAGGAACTCGAGTTCCTCTGTATCTATAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021790.1-879s1c1
Sequence:CCGGGCCTGAAGCAAGTACTCCAAACTCGAGTTTGGAGTACTTGCTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021790.1-411s1c1
Sequence:CCGGCATGGAAGATTGTCAGAATAACTCGAGTTATTCTGACAATCTTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021790.1-614s1c1
Sequence:CCGGGTGATCTTGAAATGGTACTATCTCGAGATAGTACCATTTCAAGATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021790.1-1063s1c1
Sequence:CCGGGCTTTGAGACATCCAGAAGATCTCGAGATCTTCTGGATGTCTCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks