EMAIL THIS PAGE TO A FRIEND

CENPL

centromere protein L

69 Gene Product Result for
Synonyms: C1orf155 CENP-L RP3-383J4.1 dJ383J4.3
UniProtKB ID: Q8N0S6, Q5TEL5, Q96ND4
Gene ID:
Human(91687) Summary: CENPL is a subunit of a CENPH (MIM 605607)-CENPI (MIM 300065)-associated centromeric complex that targets CENPA (MIM 117139) to centromeres and is required for proper kinetochore function and mitotic progression (Okada et al., 2006) [PubMed 16622420]
Mouse(70454) centromere protein L
Rat(289150) centromere protein L
Zebrafish(445401) centromere protein L
cow(615527) centromere protein L
Horse(100052440) centromere protein L
domestic cat(101093487) centromere protein L
dog(611220) centromere protein L
chicken(426563) centromere protein L
sheep(101113689) centromere protein L
domestic guinea pig(100727519) centromere protein L
naked mole-rat(101725168) centromere protein L
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033319 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033319 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033319 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027429 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027429 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027429 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127181 Rosetta Predictions human pricing
NM_033319 Rosetta Predictions human pricing
NM_001033061 Rosetta Predictions rat pricing
NM_027429 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127181 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328597 predicted 1734
2 SASI_Hs02_00328598 predicted 2019
3 SASI_Hs02_00328599 predicted 2030
4 SASI_Hs02_00328600 predicted 2056
5 SASI_Hs02_00328601 predicted 2031
6 SASI_Hs02_00328602 predicted 2012
7 SASI_Hs02_00328603 predicted 1719
8 SASI_Hs02_00328604 predicted 1618
9 SASI_Hs02_00328605 predicted 2019
10 SASI_Hs02_00328606 predicted 1902
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033319 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00204188 predicted 1597
2 SASI_Hs01_00204189 predicted 1883
3 SASI_Hs01_00204192 predicted 1893
4 SASI_Hs02_00361172 predicted 1919
5 SASI_Hs02_00361173 predicted 1898
6 SASI_Hs01_00204195 predicted 1875
7 SASI_Hs02_00361174 predicted 1588
8 SASI_Hs01_00204196 predicted 1483
9 SASI_Hs02_00361175 predicted 1881
10 SASI_Hs02_00361176 predicted 1770
11 SASI_Hs01_00204190 predicted 472
12 SASI_Hs01_00204191 predicted 540
13 SASI_Hs01_00204193 predicted 859
14 SASI_Hs01_00204194 predicted 397
15 SASI_Hs01_00204197 predicted 523
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033061 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00047064 predicted 826
2 SASI_Rn01_00047066 predicted 1407
3 SASI_Rn01_00047067 predicted 755
4 SASI_Rn01_00047068 predicted 779
5 SASI_Rn02_00203619 predicted 698
6 SASI_Rn01_00047069 predicted 1065
7 SASI_Rn02_00203620 predicted 740
8 SASI_Rn01_00047070 predicted 1469
9 SASI_Rn01_00047072 predicted 1013
10 SASI_Rn01_00047073 predicted 1026
11 SASI_Rn01_00047065 predicted 695
12 SASI_Rn01_00047071 predicted 1062
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027429 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00332174 predicted 703
2 SASI_Mm02_00332175 predicted 1047
3 SASI_Mm02_00332176 predicted 1033
4 SASI_Mm02_00332177 predicted 782
5 SASI_Mm02_00332178 predicted 684
6 SASI_Mm02_00332179 predicted 1085
7 SASI_Mm02_00332180 predicted 565
8 SASI_Mm02_00332181 predicted 757
9 SASI_Mm02_00332182 predicted 704
10 SASI_Mm02_00332183 predicted 945
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033319
VALIDATED
CENPL MISSION shRNA Bacterial Glycerol Stock
centromere protein L
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000136382    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033319.1-1628s1c1
Sequence:CCGGCACCTGTAATTCCAGCACTTTCTCGAGAAAGTGCTGGAATTACAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033319.1-361s1c1
Sequence:CCGGCCTCTGCAGAAACGATTAGAACTCGAGTTCTAATCGTTTCTGCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135446    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033319.1-1410s1c1
Sequence:CCGGGCATCTATCTCTGCATCTGTTCTCGAGAACAGATGCAGAGATAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033319.1-1283s1c1
Sequence:CCGGCATATTTGACAGAACTGGCAACTCGAGTTGCCAGTTCTGTCAAATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033319.1-1220s1c1
Sequence:CCGGCTTCAGCACATACTGATGGAACTCGAGTTCCATCAGTATGTGCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033319.1-1113s1c1
Sequence:CCGGCCAGGAAGAAGTTGACCTATTCTCGAGAATAGGTCAACTTCTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136142    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033319.1-366s1c1
Sequence:CCGGGCAGAAACGATTAGAATCGGTCTCGAGACCGATTCTAATCGTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033319.3-1225s21c1
Sequence:CCGGTTCAGTCCTTTAGCAATCAATCTCGAGATTGATTGCTAAAGGACTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033319.3-1570s21c1
Sequence:CCGGCTGTGTCATAAATACCTTATTCTCGAGAATAAGGTATTTATGACACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033319.3-944s21c1
Sequence:CCGGACTTCAACATCAAAGTGATTTCTCGAGAAATCACTTTGATGTTGAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033319.3-816s21c1
Sequence:CCCGGTGGACTTTATATAGTTTAACCTCGAGGTTAAACTATATAAAGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426382    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033319.3-1689s21c1
Sequence:CCGGGCCTAATTGCTATGCTGAAAGCTCGAGCTTTCAGCATAGCAATTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033319.3-1506s21c1
Sequence:CCGGCACAAGATTAGTTCGTGTTTCCTCGAGGAAACACGAACTAATCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033319.3-727s21c1
Sequence:CCGGCTGACTCCACCTCGAAGGAAACTCGAGTTTCCTTCGAGGTGGAGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033319.3-1467s21c1
Sequence:CCGGTTCACATTTCCATAGACATTTCTCGAGAAATGTCTATGGAAATGTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033319
VALIDATED
CENPL MISSION shRNA shRNA Plasmid DNA
centromere protein L
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000136382    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033319.1-1628s1c1
Sequence:CCGGCACCTGTAATTCCAGCACTTTCTCGAGAAAGTGCTGGAATTACAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033319.1-361s1c1
Sequence:CCGGCCTCTGCAGAAACGATTAGAACTCGAGTTCTAATCGTTTCTGCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135446    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033319.1-1410s1c1
Sequence:CCGGGCATCTATCTCTGCATCTGTTCTCGAGAACAGATGCAGAGATAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033319.1-1283s1c1
Sequence:CCGGCATATTTGACAGAACTGGCAACTCGAGTTGCCAGTTCTGTCAAATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033319.1-1220s1c1
Sequence:CCGGCTTCAGCACATACTGATGGAACTCGAGTTCCATCAGTATGTGCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033319.1-1113s1c1
Sequence:CCGGCCAGGAAGAAGTTGACCTATTCTCGAGAATAGGTCAACTTCTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136142    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033319.1-366s1c1
Sequence:CCGGGCAGAAACGATTAGAATCGGTCTCGAGACCGATTCTAATCGTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033319.3-1225s21c1
Sequence:CCGGTTCAGTCCTTTAGCAATCAATCTCGAGATTGATTGCTAAAGGACTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033319.3-1570s21c1
Sequence:CCGGCTGTGTCATAAATACCTTATTCTCGAGAATAAGGTATTTATGACACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033319.3-944s21c1
Sequence:CCGGACTTCAACATCAAAGTGATTTCTCGAGAAATCACTTTGATGTTGAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033319.3-816s21c1
Sequence:CCCGGTGGACTTTATATAGTTTAACCTCGAGGTTAAACTATATAAAGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426382    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033319.3-1689s21c1
Sequence:CCGGGCCTAATTGCTATGCTGAAAGCTCGAGCTTTCAGCATAGCAATTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033319.3-1506s21c1
Sequence:CCGGCACAAGATTAGTTCGTGTTTCCTCGAGGAAACACGAACTAATCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033319.3-727s21c1
Sequence:CCGGCTGACTCCACCTCGAAGGAAACTCGAGTTTCCTTCGAGGTGGAGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033319.3-1467s21c1
Sequence:CCGGTTCACATTTCCATAGACATTTCTCGAGAAATGTCTATGGAAATGTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033319
VALIDATED
CENPL MISSION shRNA Lentiviral Transduction Particles
centromere protein L
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000136382    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033319.1-1628s1c1
Sequence:CCGGCACCTGTAATTCCAGCACTTTCTCGAGAAAGTGCTGGAATTACAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033319.1-361s1c1
Sequence:CCGGCCTCTGCAGAAACGATTAGAACTCGAGTTCTAATCGTTTCTGCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135446    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033319.1-1410s1c1
Sequence:CCGGGCATCTATCTCTGCATCTGTTCTCGAGAACAGATGCAGAGATAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033319.1-1283s1c1
Sequence:CCGGCATATTTGACAGAACTGGCAACTCGAGTTGCCAGTTCTGTCAAATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033319.1-1220s1c1
Sequence:CCGGCTTCAGCACATACTGATGGAACTCGAGTTCCATCAGTATGTGCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033319.1-1113s1c1
Sequence:CCGGCCAGGAAGAAGTTGACCTATTCTCGAGAATAGGTCAACTTCTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136142    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033319.1-366s1c1
Sequence:CCGGGCAGAAACGATTAGAATCGGTCTCGAGACCGATTCTAATCGTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033319.3-1225s21c1
Sequence:CCGGTTCAGTCCTTTAGCAATCAATCTCGAGATTGATTGCTAAAGGACTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033319.3-1570s21c1
Sequence:CCGGCTGTGTCATAAATACCTTATTCTCGAGAATAAGGTATTTATGACACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033319.3-944s21c1
Sequence:CCGGACTTCAACATCAAAGTGATTTCTCGAGAAATCACTTTGATGTTGAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033319.3-816s21c1
Sequence:CCCGGTGGACTTTATATAGTTTAACCTCGAGGTTAAACTATATAAAGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426382    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033319.3-1689s21c1
Sequence:CCGGGCCTAATTGCTATGCTGAAAGCTCGAGCTTTCAGCATAGCAATTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033319.3-1506s21c1
Sequence:CCGGCACAAGATTAGTTCGTGTTTCCTCGAGGAAACACGAACTAATCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033319.3-727s21c1
Sequence:CCGGCTGACTCCACCTCGAAGGAAACTCGAGTTTCCTTCGAGGTGGAGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033319.3-1467s21c1
Sequence:CCGGTTCACATTTCCATAGACATTTCTCGAGAAATGTCTATGGAAATGTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027429
VALIDATED
CENPL MISSION shRNA Bacterial Glycerol Stock
centromere protein L
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000183236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027429.1-1264s1c1
Sequence:CCGGGACTTATTTATGAACTGCCTTCTCGAGAAGGCAGTTCATAAATAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027429.1-989s1c1
Sequence:CCGGCGGAGTCCAATACATCTTTAACTCGAGTTAAAGATGTATTGGACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027429.1-624s1c1
Sequence:CCGGCCTCCACAAACAGTGGACTATCTCGAGATAGTCCACTGTTTGTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027429.1-814s1c1
Sequence:CCGGCAAAGGGACCATGAAGCGTTTCTCGAGAAACGCTTCATGGTCCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027429
VALIDATED
CENPL MISSION shRNA shRNA Plasmid DNA
centromere protein L
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000183236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027429.1-1264s1c1
Sequence:CCGGGACTTATTTATGAACTGCCTTCTCGAGAAGGCAGTTCATAAATAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027429.1-989s1c1
Sequence:CCGGCGGAGTCCAATACATCTTTAACTCGAGTTAAAGATGTATTGGACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027429.1-624s1c1
Sequence:CCGGCCTCCACAAACAGTGGACTATCTCGAGATAGTCCACTGTTTGTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027429.1-814s1c1
Sequence:CCGGCAAAGGGACCATGAAGCGTTTCTCGAGAAACGCTTCATGGTCCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027429
VALIDATED
CENPL MISSION shRNA Lentiviral Transduction Particles
centromere protein L
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000183236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027429.1-1264s1c1
Sequence:CCGGGACTTATTTATGAACTGCCTTCTCGAGAAGGCAGTTCATAAATAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027429.1-989s1c1
Sequence:CCGGCGGAGTCCAATACATCTTTAACTCGAGTTAAAGATGTATTGGACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027429.1-624s1c1
Sequence:CCGGCCTCCACAAACAGTGGACTATCTCGAGATAGTCCACTGTTTGTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027429.1-814s1c1
Sequence:CCGGCAAAGGGACCATGAAGCGTTTCTCGAGAAACGCTTCATGGTCCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks