EMAIL THIS PAGE TO A FRIEND

CENPM

centromere protein M

Synonyms: C22orf18 CENP-M PANE1 bK250D10.2
UniProtKB ID: Q9NSP4, A7LM22, B1AHQ9, Q6I9W3
Gene ID:
Human(79019) Summary: The centromere is a specialized chromatin domain, present throughout the cell cycle, that acts as a platform on which the transient assembly of the kinetochore occurs during mitosis. All active centromeres are characterized by the presence of long arrays of nucleosomes in which CENPA (MIM 117139) replaces histone H3 (see MIM 601128). CENPM is an additional factor required for centromere assembly (Foltz et al., 2006 [PubMed 16622419]
Mouse(66570) centromere protein M
Rat(315164) centromere protein M
naked mole-rat(101699674) centromere protein M
domestic guinea pig(100713654) centromere protein M
sheep(101113226) centromere protein M
chicken(417982) centromere protein M
dog(609678) centromere protein M
Horse(100070735) centromere protein M
cow(615953) centromere protein M
domestic cat(101082761) centromere protein M
101 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0812 AQUA Peptide CDLEVESGG[R] human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024053 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024053 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024053 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178269 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178269 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178269 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001002876 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001002876 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001002876 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001002876 Rosetta Predictions human pricing
NM_001110215 Rosetta Predictions human pricing
NM_024053 Rosetta Predictions human pricing
NM_001130504 Rosetta Predictions rat pricing
NM_001080158 Rosetta Predictions mouse pricing
NM_025639 Rosetta Predictions mouse pricing
NM_178269 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002876 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00144699 predicted 252
2 SASI_Hs01_00144700 predicted 365
3 SASI_Hs01_00144701 predicted 265
4 SASI_Hs01_00144702 predicted 253
5 SASI_Hs01_00144703 predicted 258
6 SASI_Hs01_00144704 predicted 552
7 SASI_Hs01_00144706 predicted 555
8 SASI_Hs01_00144707 predicted 318
9 SASI_Hs01_00144708 predicted 318
10 SASI_Hs02_00304234 predicted 248
11 SASI_Hs01_00144705 predicted 270
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110215 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324865 predicted 284
2 SASI_Hs02_00324866 predicted 254
3 SASI_Hs02_00324867 predicted 257
4 SASI_Hs02_00324868 predicted 427
5 SASI_Hs02_00324869 predicted 257
6 SASI_Hs02_00324870 predicted 434
7 SASI_Hs02_00324871 predicted 256
8 SASI_Hs02_00324872 predicted 482
9 SASI_Hs02_00324873 predicted 468
10 SASI_Hs02_00324874 predicted 269
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024053 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00082908 predicted 249
2 SASI_Hs01_00082909 predicted 257
3 SASI_Hs01_00082910 predicted 253
4 SASI_Hs01_00082912 predicted 417
5 SASI_Hs01_00082913 predicted 639
6 SASI_Hs01_00082915 predicted 641
7 SASI_Hs01_00082916 predicted 317
8 SASI_Hs01_00082917 predicted 418
9 SASI_Hs02_00356501 predicted 320
10 SASI_Hs02_00356502 predicted 242
11 SASI_Hs01_00082911 predicted 271
12 SASI_Hs01_00082914 predicted 272
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130504 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00255469 predicted 213
2 SASI_Rn02_00255470 predicted 243
3 SASI_Rn02_00255471 predicted 279
4 SASI_Rn02_00255472 predicted 524
5 SASI_Rn02_00255473 predicted 623
6 SASI_Rn02_00255474 predicted 548
7 SASI_Rn02_00255475 predicted 271
8 SASI_Rn02_00255476 predicted 533
9 SASI_Rn02_00255477 predicted 295
10 SASI_Rn02_00255478 predicted 261
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080158 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00293373 predicted 498
2 SASI_Mm02_00293374 predicted 897
3 SASI_Mm02_00293375 predicted 1061
4 SASI_Mm02_00293376 predicted 915
5 SASI_Mm02_00293377 predicted 247
6 SASI_Mm02_00293378 predicted 390
7 SASI_Mm02_00293379 predicted 1051
8 SASI_Mm02_00293380 predicted 806
9 SASI_Mm02_00293381 predicted 1109
10 SASI_Mm02_00293382 predicted 547
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025639 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00328720 predicted 499
2 SASI_Mm02_00328721 predicted 898
3 SASI_Mm02_00328722 predicted 1066
4 SASI_Mm02_00328723 predicted 908
5 SASI_Mm02_00328724 predicted 251
6 SASI_Mm02_00328725 predicted 387
7 SASI_Mm02_00328726 predicted 1052
8 SASI_Mm02_00328727 predicted 805
9 SASI_Mm02_00328728 predicted 1112
10 SASI_Mm02_00328729 predicted 549
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178269 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00348706 predicted 1054
2 SASI_Mm02_00348707 predicted 1066
3 SASI_Mm02_00348708 predicted 803
4 SASI_Mm02_00348709 predicted 822
5 SASI_Mm02_00348710 predicted 957
6 SASI_Mm02_00348711 predicted 1058
7 SASI_Mm02_00348712 predicted 944
8 SASI_Mm02_00348713 predicted 1019
9 SASI_Mm02_00348714 predicted 819
10 SASI_Mm02_00348715 predicted 243
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024053
VALIDATED
CENPM MISSION shRNA Bacterial Glycerol Stock
centromere protein M
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000351001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_024053.3-226s21c1
Sequence:CCGGCTTTGCCCTCCAGTGTGAATCCTCGAGGATTCACACTGGAGGGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024053.3-263s21c1
Sequence:CCGGGATCGTGTTTGTGGTTAATCTCTCGAGAGATTAACCACAAACACGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024053.3-251s21c1
Sequence:CCGGCCGAATTGACCTGATCGTGTTCTCGAGAACACGATCAGGTCAATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350935    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024053.3-645s21c1
Sequence:CCGGGCTTCGTGCTGACTCCATAAACTCGAGTTTATGGAGTCAGCACGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024053
VALIDATED
CENPM MISSION shRNA shRNA Plasmid DNA
centromere protein M
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000351001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_024053.3-226s21c1
Sequence:CCGGCTTTGCCCTCCAGTGTGAATCCTCGAGGATTCACACTGGAGGGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024053.3-263s21c1
Sequence:CCGGGATCGTGTTTGTGGTTAATCTCTCGAGAGATTAACCACAAACACGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024053.3-251s21c1
Sequence:CCGGCCGAATTGACCTGATCGTGTTCTCGAGAACACGATCAGGTCAATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350935    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024053.3-645s21c1
Sequence:CCGGGCTTCGTGCTGACTCCATAAACTCGAGTTTATGGAGTCAGCACGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024053
VALIDATED
CENPM MISSION shRNA Lentiviral Transduction Particles
centromere protein M
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000351001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_024053.3-226s21c1
Sequence:CCGGCTTTGCCCTCCAGTGTGAATCCTCGAGGATTCACACTGGAGGGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024053.3-263s21c1
Sequence:CCGGGATCGTGTTTGTGGTTAATCTCTCGAGAGATTAACCACAAACACGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024053.3-251s21c1
Sequence:CCGGCCGAATTGACCTGATCGTGTTCTCGAGAACACGATCAGGTCAATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350935    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024053.3-645s21c1
Sequence:CCGGGCTTCGTGCTGACTCCATAAACTCGAGTTTATGGAGTCAGCACGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178269
VALIDATED
CENPM MISSION shRNA Bacterial Glycerol Stock
centromere protein M
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000336353    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178269.3-726s21c1
Sequence:CCGGTGCACCTGTCTAACATCATAACTCGAGTTATGATGTTAGACAGGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178269.3-537s21c1
Sequence:CCGGACGTTTGCTGCCAGTTCCAAACTCGAGTTTGGAACTGGCAGCAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178269.3-261s21c1
Sequence:CCGGCTGATTGTGTTTGTGATTAACCTCGAGGTTAATCACAAACACAATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178269.3-506s21c1
Sequence:CCGGCCAAGGAGCTGTGAGCATTACCTCGAGGTAATGCTCACAGCTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178269.3-289s21c1
Sequence:CCGGGCAAATACAGTCTCCAGAAAGCTCGAGCTTTCTGGAGACTGTATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125094    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178269.1-507s1c1
Sequence:CCGGTCCAAGGAGCTGTGAGCATTACTCGAGTAATGCTCACAGCTCCTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178269.1-288s1c1
Sequence:CCGGCAGCAAATACAGTCTCCAGAACTCGAGTTCTGGAGACTGTATTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178269.1-274s1c1
Sequence:CCGGGTGATTAACCTGCACAGCAAACTCGAGTTTGCTGTGCAGGTTAATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178269.1-163s1c1
Sequence:CCGGGCGGAGTCGATGCTCAAAGATCTCGAGATCTTTGAGCATCGACTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178269.1-261s1c1
Sequence:CCGGCCTGATTGTGTTTGTGATTAACTCGAGTTAATCACAAACACAATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178269
VALIDATED
CENPM MISSION shRNA shRNA Plasmid DNA
centromere protein M
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000336353    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178269.3-726s21c1
Sequence:CCGGTGCACCTGTCTAACATCATAACTCGAGTTATGATGTTAGACAGGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178269.3-537s21c1
Sequence:CCGGACGTTTGCTGCCAGTTCCAAACTCGAGTTTGGAACTGGCAGCAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178269.3-261s21c1
Sequence:CCGGCTGATTGTGTTTGTGATTAACCTCGAGGTTAATCACAAACACAATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178269.3-506s21c1
Sequence:CCGGCCAAGGAGCTGTGAGCATTACCTCGAGGTAATGCTCACAGCTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178269.3-289s21c1
Sequence:CCGGGCAAATACAGTCTCCAGAAAGCTCGAGCTTTCTGGAGACTGTATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125094    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178269.1-507s1c1
Sequence:CCGGTCCAAGGAGCTGTGAGCATTACTCGAGTAATGCTCACAGCTCCTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178269.1-288s1c1
Sequence:CCGGCAGCAAATACAGTCTCCAGAACTCGAGTTCTGGAGACTGTATTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178269.1-274s1c1
Sequence:CCGGGTGATTAACCTGCACAGCAAACTCGAGTTTGCTGTGCAGGTTAATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178269.1-163s1c1
Sequence:CCGGGCGGAGTCGATGCTCAAAGATCTCGAGATCTTTGAGCATCGACTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178269.1-261s1c1
Sequence:CCGGCCTGATTGTGTTTGTGATTAACTCGAGTTAATCACAAACACAATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178269
VALIDATED
CENPM MISSION shRNA Lentiviral Transduction Particles
centromere protein M
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000336353    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178269.3-726s21c1
Sequence:CCGGTGCACCTGTCTAACATCATAACTCGAGTTATGATGTTAGACAGGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178269.3-537s21c1
Sequence:CCGGACGTTTGCTGCCAGTTCCAAACTCGAGTTTGGAACTGGCAGCAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178269.3-261s21c1
Sequence:CCGGCTGATTGTGTTTGTGATTAACCTCGAGGTTAATCACAAACACAATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178269.3-506s21c1
Sequence:CCGGCCAAGGAGCTGTGAGCATTACCTCGAGGTAATGCTCACAGCTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178269.3-289s21c1
Sequence:CCGGGCAAATACAGTCTCCAGAAAGCTCGAGCTTTCTGGAGACTGTATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125094    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178269.1-507s1c1
Sequence:CCGGTCCAAGGAGCTGTGAGCATTACTCGAGTAATGCTCACAGCTCCTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178269.1-288s1c1
Sequence:CCGGCAGCAAATACAGTCTCCAGAACTCGAGTTCTGGAGACTGTATTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178269.1-274s1c1
Sequence:CCGGGTGATTAACCTGCACAGCAAACTCGAGTTTGCTGTGCAGGTTAATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178269.1-163s1c1
Sequence:CCGGGCGGAGTCGATGCTCAAAGATCTCGAGATCTTTGAGCATCGACTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178269.1-261s1c1
Sequence:CCGGCCTGATTGTGTTTGTGATTAACTCGAGTTAATCACAAACACAATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001002876
VALIDATED
CENPM MISSION shRNA Bacterial Glycerol Stock
centromere protein M
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000157573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001002876.1-258s1c1
Sequence:CCGGGACCTGATCGTGTTTGTGGTTCTCGAGAACCACAAACACGATCAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156552    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001002876.1-553s1c1
Sequence:CCGGGCTTCGTGCTGACTCCATAAACTCGAGTTTATGGAGTCAGCACGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002876.1-252s1c1
Sequence:CCGGCGAATTGACCTGATCGTGTTTCTCGAGAAACACGATCAGGTCAATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155634    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002876.1-287s1c1
Sequence:CCGGCAGCAAATACAGTCTCCAGAACTCGAGTTCTGGAGACTGTATTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_001002876.1-263s1c1
Sequence:CCGGGATCGTGTTTGTGGTTAATCTCTCGAGAGATTAACCACAAACACGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_001002876.1-251s1c1
Sequence:CCGGCCGAATTGACCTGATCGTGTTCTCGAGAACACGATCAGGTCAATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001002876
VALIDATED
CENPM MISSION shRNA shRNA Plasmid DNA
centromere protein M
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000157573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001002876.1-258s1c1
Sequence:CCGGGACCTGATCGTGTTTGTGGTTCTCGAGAACCACAAACACGATCAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156552    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001002876.1-553s1c1
Sequence:CCGGGCTTCGTGCTGACTCCATAAACTCGAGTTTATGGAGTCAGCACGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002876.1-252s1c1
Sequence:CCGGCGAATTGACCTGATCGTGTTTCTCGAGAAACACGATCAGGTCAATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155634    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002876.1-287s1c1
Sequence:CCGGCAGCAAATACAGTCTCCAGAACTCGAGTTCTGGAGACTGTATTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_001002876.1-263s1c1
Sequence:CCGGGATCGTGTTTGTGGTTAATCTCTCGAGAGATTAACCACAAACACGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_001002876.1-251s1c1
Sequence:CCGGCCGAATTGACCTGATCGTGTTCTCGAGAACACGATCAGGTCAATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001002876
VALIDATED
CENPM MISSION shRNA Lentiviral Transduction Particles
centromere protein M
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000157573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001002876.1-258s1c1
Sequence:CCGGGACCTGATCGTGTTTGTGGTTCTCGAGAACCACAAACACGATCAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156552    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001002876.1-553s1c1
Sequence:CCGGGCTTCGTGCTGACTCCATAAACTCGAGTTTATGGAGTCAGCACGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002876.1-252s1c1
Sequence:CCGGCGAATTGACCTGATCGTGTTTCTCGAGAAACACGATCAGGTCAATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155634    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002876.1-287s1c1
Sequence:CCGGCAGCAAATACAGTCTCCAGAACTCGAGTTCTGGAGACTGTATTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_001002876.1-263s1c1
Sequence:CCGGGATCGTGTTTGTGGTTAATCTCTCGAGAGATTAACCACAAACACGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_001002876.1-251s1c1
Sequence:CCGGCCGAATTGACCTGATCGTGTTCTCGAGAACACGATCAGGTCAATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks