EMAIL THIS PAGE TO A FRIEND

CENPN

centromere protein N

74 Gene Product Result for
Synonyms: BM039 C16orf60 CENP-N ICEN32
Gene ID:
Human(55839) Summary: The protein encoded by this gene forms part of the nucleosome-associated complex and is important for kinetochore assembly. It is bound to kinetochores during S phase and G2 and recruits other proteins to the centromere. Pseudogenes of this gene are located on chromosome 2. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jul 2012]
Mouse(72155) centromere protein N
Rat(361416) centromere protein N
Zebrafish(368856) centromere protein N
dog(479635) centromere protein N
cow(513551) centromere protein N
domestic cat(101100773) centromere protein N
chicken(693246) centromere protein N
sheep(101121445) centromere protein N
domestic guinea pig(100722125) centromere protein N
naked mole-rat(101696337) centromere protein N
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018455 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018455 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018455 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028131 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028131 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028131 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001100624 Rosetta Predictions human pricing
NM_001100625 Rosetta Predictions human pricing
NM_018455 Rosetta Predictions human pricing
NM_001008366 Rosetta Predictions rat pricing
NM_028131 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100624 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322304 predicted 797
2 SASI_Hs02_00322305 predicted 990
3 SASI_Hs02_00322306 predicted 978
4 SASI_Hs02_00322307 predicted 907
5 SASI_Hs02_00322308 predicted 790
6 SASI_Hs02_00322309 predicted 897
7 SASI_Hs02_00322310 predicted 922
8 SASI_Hs02_00322311 predicted 1023
9 SASI_Hs02_00322312 predicted 1021
10 SASI_Hs02_00322313 predicted 919
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100625 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322314 predicted 796
2 SASI_Hs02_00322315 predicted 991
3 SASI_Hs02_00322316 predicted 974
4 SASI_Hs02_00322317 predicted 908
5 SASI_Hs02_00322318 predicted 789
6 SASI_Hs02_00322319 predicted 899
7 SASI_Hs02_00322320 predicted 924
8 SASI_Hs02_00322321 predicted 1022
9 SASI_Hs02_00322322 predicted 1023
10 SASI_Hs02_00322323 predicted 920
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018455 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00352001 predicted 797
2 SASI_Hs02_00352002 predicted 997
3 SASI_Hs01_00096976 predicted 976
4 SASI_Hs01_00096977 predicted 907
5 SASI_Hs01_00096978 predicted 796
6 SASI_Hs02_00352003 predicted 893
7 SASI_Hs02_00352004 predicted 916
8 SASI_Hs01_00096981 predicted 1018
9 SASI_Hs02_00352005 predicted 1019
10 SASI_Hs02_00352006 predicted 919
11 SASI_Hs01_00096974 predicted 942
12 SASI_Hs01_00096975 predicted 1167
13 SASI_Hs01_00096979 predicted 942
14 SASI_Hs01_00096980 predicted 1123
15 SASI_Hs01_00096982 predicted 937
16 SASI_Hs01_00096983 predicted 1016
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008366 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00046994 predicted 816
2 SASI_Rn01_00046995 predicted 902
3 SASI_Rn01_00046996 predicted 454
4 SASI_Rn01_00046997 predicted 1006
5 SASI_Rn01_00046998 predicted 658
6 SASI_Rn01_00047000 predicted 742
7 SASI_Rn01_00047001 predicted 1227
8 SASI_Rn01_00047002 predicted 830
9 SASI_Rn01_00047003 predicted 341
10 SASI_Rn02_00199135 predicted 1329
11 SASI_Rn01_00046999 predicted 544
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028131 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00170994 predicted 237
2 SASI_Mm01_00170995 predicted 948
3 SASI_Mm01_00170996 predicted 1088
4 SASI_Mm01_00170998 predicted 695
5 SASI_Mm01_00170999 predicted 705
6 SASI_Mm01_00171000 predicted 961
7 SASI_Mm01_00171001 predicted 470
8 SASI_Mm01_00171002 predicted 1247
9 SASI_Mm01_00171003 predicted 1260
10 SASI_Mm02_00333399 predicted 972
11 SASI_Mm01_00170997 predicted 267
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018455
VALIDATED
CENPN MISSION shRNA Bacterial Glycerol Stock
centromere protein N
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000000321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_018455.x-802s1c1
Sequence:CCGGTGAACTGACAACAATCCTGAACTCGAGTTCAGGATTGTTGTCAGTTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_018455.x-1006s1c1
Sequence:CCGGGATGAGTAAAGGACCAGGTGACTCGAGTCACCTGGTCCTTTACTCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_018455.x-1115s1c1
Sequence:CCGGAGAGAAACTGAGGAGAATGCACTCGAGTGCATTCTCCTCAGTTTCTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_018455.x-1007s1c1
Sequence:CCGGATGAGTAAAGGACCAGGTGAACTCGAGTTCACCTGGTCCTTTACTCATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_018455.x-1162s1c1
Sequence:CCGGACAGTACACAAAGCCAAACCACTCGAGTGGTTTGGCTTTGTGTACTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_018455.4-1051s21c1
Sequence:CCGGGATGAGTAAAGGACCAGGTGACTCGAGTCACCTGGTCCTTTACTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_018455.4-989s21c1
Sequence:CCGGGCCCTGTTAGACATCATTTATCTCGAGATAAATGATGTCTAACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_018455.4-847s21c1
Sequence:CCGGTGAACTGACAACAATCCTGAACTCGAGTTCAGGATTGTTGTCAGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_018455.4-1207s21c1
Sequence:CCGGACAGTACACAAAGCCAAACCACTCGAGTGGTTTGGCTTTGTGTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_018455.4-1160s21c1
Sequence:CCGGAGAGAAACTGAGGAGAATGCACTCGAGTGCATTCTCCTCAGTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018455
VALIDATED
CENPN MISSION shRNA shRNA Plasmid DNA
centromere protein N
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000000321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_018455.x-802s1c1
Sequence:CCGGTGAACTGACAACAATCCTGAACTCGAGTTCAGGATTGTTGTCAGTTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_018455.x-1006s1c1
Sequence:CCGGGATGAGTAAAGGACCAGGTGACTCGAGTCACCTGGTCCTTTACTCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_018455.x-1115s1c1
Sequence:CCGGAGAGAAACTGAGGAGAATGCACTCGAGTGCATTCTCCTCAGTTTCTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_018455.x-1007s1c1
Sequence:CCGGATGAGTAAAGGACCAGGTGAACTCGAGTTCACCTGGTCCTTTACTCATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_018455.x-1162s1c1
Sequence:CCGGACAGTACACAAAGCCAAACCACTCGAGTGGTTTGGCTTTGTGTACTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_018455.4-1051s21c1
Sequence:CCGGGATGAGTAAAGGACCAGGTGACTCGAGTCACCTGGTCCTTTACTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_018455.4-989s21c1
Sequence:CCGGGCCCTGTTAGACATCATTTATCTCGAGATAAATGATGTCTAACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_018455.4-847s21c1
Sequence:CCGGTGAACTGACAACAATCCTGAACTCGAGTTCAGGATTGTTGTCAGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_018455.4-1207s21c1
Sequence:CCGGACAGTACACAAAGCCAAACCACTCGAGTGGTTTGGCTTTGTGTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_018455.4-1160s21c1
Sequence:CCGGAGAGAAACTGAGGAGAATGCACTCGAGTGCATTCTCCTCAGTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018455
VALIDATED
CENPN MISSION shRNA Lentiviral Transduction Particles
centromere protein N
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000000321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_018455.x-802s1c1
Sequence:CCGGTGAACTGACAACAATCCTGAACTCGAGTTCAGGATTGTTGTCAGTTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_018455.x-1006s1c1
Sequence:CCGGGATGAGTAAAGGACCAGGTGACTCGAGTCACCTGGTCCTTTACTCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_018455.x-1115s1c1
Sequence:CCGGAGAGAAACTGAGGAGAATGCACTCGAGTGCATTCTCCTCAGTTTCTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_018455.x-1007s1c1
Sequence:CCGGATGAGTAAAGGACCAGGTGAACTCGAGTTCACCTGGTCCTTTACTCATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_018455.x-1162s1c1
Sequence:CCGGACAGTACACAAAGCCAAACCACTCGAGTGGTTTGGCTTTGTGTACTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_018455.4-1051s21c1
Sequence:CCGGGATGAGTAAAGGACCAGGTGACTCGAGTCACCTGGTCCTTTACTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_018455.4-989s21c1
Sequence:CCGGGCCCTGTTAGACATCATTTATCTCGAGATAAATGATGTCTAACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_018455.4-847s21c1
Sequence:CCGGTGAACTGACAACAATCCTGAACTCGAGTTCAGGATTGTTGTCAGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_018455.4-1207s21c1
Sequence:CCGGACAGTACACAAAGCCAAACCACTCGAGTGGTTTGGCTTTGTGTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_018455.4-1160s21c1
Sequence:CCGGAGAGAAACTGAGGAGAATGCACTCGAGTGCATTCTCCTCAGTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028131
VALIDATED
CENPN MISSION shRNA Bacterial Glycerol Stock
centromere protein N
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028131.1-911s1c1
Sequence:CCGGCGAGTCACTCAAGAGACCTTTCTCGAGAAAGGTCTCTTGAGTGACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192914    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_028131.1-1373s1c1
Sequence:CCGGGTGGGCATTTGACAAGTGATACTCGAGTATCACTTGTCAAATGCCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028131.1-266s1c1
Sequence:CCGGGAAGACCAACTACAAACCATACTCGAGTATGGTTTGTAGTTGGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028131.1-725s1c1
Sequence:CCGGCATCAGATTGTGCATTTGGATCTCGAGATCCAAATGCACAATCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028131.3-376s21c1
Sequence:CCGGGACATCGTGTATACTCAATTTCTCGAGAAATTGAGTATACACGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028131.3-724s21c1
Sequence:CCGGCATCAGATTGTGCATTTGGATCTCGAGATCCAAATGCACAATCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340802    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028131.3-1340s21c1
Sequence:CCGGCTCTCTCTTCCCGTCTATTAACTCGAGTTAATAGACGGGAAGAGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028131.3-910s21c1
Sequence:CCGGCGAGTCACTCAAGAGACCTTTCTCGAGAAAGGTCTCTTGAGTGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028131.3-611s21c1
Sequence:CCGGAGCCCACGTTCGTGGTGTATTCTCGAGAATACACCACGAACGTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028131
VALIDATED
CENPN MISSION shRNA shRNA Plasmid DNA
centromere protein N
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028131.1-911s1c1
Sequence:CCGGCGAGTCACTCAAGAGACCTTTCTCGAGAAAGGTCTCTTGAGTGACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192914    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_028131.1-1373s1c1
Sequence:CCGGGTGGGCATTTGACAAGTGATACTCGAGTATCACTTGTCAAATGCCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028131.1-266s1c1
Sequence:CCGGGAAGACCAACTACAAACCATACTCGAGTATGGTTTGTAGTTGGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028131.1-725s1c1
Sequence:CCGGCATCAGATTGTGCATTTGGATCTCGAGATCCAAATGCACAATCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028131.3-376s21c1
Sequence:CCGGGACATCGTGTATACTCAATTTCTCGAGAAATTGAGTATACACGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028131.3-724s21c1
Sequence:CCGGCATCAGATTGTGCATTTGGATCTCGAGATCCAAATGCACAATCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340802    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028131.3-1340s21c1
Sequence:CCGGCTCTCTCTTCCCGTCTATTAACTCGAGTTAATAGACGGGAAGAGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028131.3-910s21c1
Sequence:CCGGCGAGTCACTCAAGAGACCTTTCTCGAGAAAGGTCTCTTGAGTGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028131.3-611s21c1
Sequence:CCGGAGCCCACGTTCGTGGTGTATTCTCGAGAATACACCACGAACGTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028131
VALIDATED
CENPN MISSION shRNA Lentiviral Transduction Particles
centromere protein N
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028131.1-911s1c1
Sequence:CCGGCGAGTCACTCAAGAGACCTTTCTCGAGAAAGGTCTCTTGAGTGACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192914    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_028131.1-1373s1c1
Sequence:CCGGGTGGGCATTTGACAAGTGATACTCGAGTATCACTTGTCAAATGCCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028131.1-266s1c1
Sequence:CCGGGAAGACCAACTACAAACCATACTCGAGTATGGTTTGTAGTTGGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028131.1-725s1c1
Sequence:CCGGCATCAGATTGTGCATTTGGATCTCGAGATCCAAATGCACAATCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028131.3-376s21c1
Sequence:CCGGGACATCGTGTATACTCAATTTCTCGAGAAATTGAGTATACACGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028131.3-724s21c1
Sequence:CCGGCATCAGATTGTGCATTTGGATCTCGAGATCCAAATGCACAATCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340802    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028131.3-1340s21c1
Sequence:CCGGCTCTCTCTTCCCGTCTATTAACTCGAGTTAATAGACGGGAAGAGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028131.3-910s21c1
Sequence:CCGGCGAGTCACTCAAGAGACCTTTCTCGAGAAAGGTCTCTTGAGTGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028131.3-611s21c1
Sequence:CCGGAGCCCACGTTCGTGGTGTATTCTCGAGAATACACCACGAACGTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks