EMAIL THIS PAGE TO A FRIEND

CENPO

centromere protein O

Synonyms: CENP-O ICEN-36 MCM21R
UniProtKB ID: Q9BU64, B2RDC0, D6W536, Q53T55, Q96JV3
Gene ID:
Human(79172) Summary: This gene encodes a component of the interphase centromere complex. The encoded protein is localized to the centromere throughout the cell cycle and is required for bipolar spindle assembly, chromosome segregation and checkpoint signaling during mitosis. Alternatively spliced transcript variants encoding multiple protein isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
Mouse(52504) centromere protein O
Rat(684439) centromere protein O
naked mole-rat(101715402) centromere protein O
domestic guinea pig(100720261) centromere protein O
sheep(101107680) centromere protein O
Zebrafish(100126022) centromere protein O
cow(767930) centromere protein O
domestic cat(101094339) centromere protein O
dog(610857) centromere protein O
chicken(422014) centromere protein O
44 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_134046 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134046 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134046 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024322 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024322 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024322 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024322 Rosetta Predictions human pricing
XM_001070398 Rosetta Predictions rat pricing
NM_134046 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024322 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00127125 predicted 765
2 SASI_Hs01_00127126 predicted 1106
3 SASI_Hs01_00127127 predicted 586
4 SASI_Hs01_00127128 predicted 756
5 SASI_Hs01_00127134 predicted 967
6 SASI_Hs02_00356668 predicted 951
7 SASI_Hs01_00127129 predicted 342
8 SASI_Hs01_00127130 predicted 431
9 SASI_Hs01_00127131 predicted 408
10 SASI_Hs01_00127132 predicted 203
11 SASI_Hs01_00127133 predicted 661
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070398 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00331518 predicted 397
2 SASI_Rn02_00331519 predicted 944
3 SASI_Rn02_00331520 predicted 869
4 SASI_Rn02_00331521 predicted 531
5 SASI_Rn02_00331522 predicted 567
6 SASI_Rn02_00331523 predicted 235
7 SASI_Rn02_00331524 predicted 216
8 SASI_Rn02_00331525 predicted 257
9 SASI_Rn02_00331526 predicted 307
10 SASI_Rn02_00331527 predicted 927
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134046 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00120575 predicted 1011
2 SASI_Mm01_00120576 predicted 1141
3 SASI_Mm01_00120577 predicted 1208
4 SASI_Mm01_00120578 predicted 687
5 SASI_Mm01_00120579 predicted 700
6 SASI_Mm01_00120580 predicted 1185
7 SASI_Mm01_00120581 predicted 906
8 SASI_Mm01_00120582 predicted 1552
9 SASI_Mm01_00120583 predicted 1157
10 SASI_Mm01_00120584 predicted 721
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134046
VALIDATED
CENPO MISSION shRNA Bacterial Glycerol Stock
centromere protein O
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000329468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_134046.5-1146s21c1
Sequence:CCGGCCTGTTTAGACTCTGGGAATACTCGAGTATTCCCAGAGTCTAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329403    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_134046.5-1956s21c1
Sequence:CCGGGCATGTGCTGGGCCACTATTTCTCGAGAAATAGTGGCCCAGCACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134046.5-1267s21c1
Sequence:CCGGTTGCTGTCGTTCACCTATAAACTCGAGTTTATAGGTGAACGACAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134046.5-783s21c1
Sequence:CCGGACTGCGGCAACAACGAGATAACTCGAGTTATCTCGTTGTTGCCGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134046.5-695s21c1
Sequence:CCGGTAGAGGCTCAAACGAACATATCTCGAGATATGTTCGTTTGAGCCTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_134046.3-701s1c1
Sequence:CCGGGCTCAAACGAACATATCGAATCTCGAGATTCGATATGTTCGTTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_134046.3-1359s1c1
Sequence:CCGGCCACGAATGTCACTGTGACAACTCGAGTTGTCACAGTGACATTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134046.3-702s1c1
Sequence:CCGGCTCAAACGAACATATCGAATACTCGAGTATTCGATATGTTCGTTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134046.3-1147s1c1
Sequence:CCGGCCTGTTTAGACTCTGGGAATACTCGAGTATTCCCAGAGTCTAAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134046
VALIDATED
CENPO MISSION shRNA shRNA Plasmid DNA
centromere protein O
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000329468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_134046.5-1146s21c1
Sequence:CCGGCCTGTTTAGACTCTGGGAATACTCGAGTATTCCCAGAGTCTAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329403    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_134046.5-1956s21c1
Sequence:CCGGGCATGTGCTGGGCCACTATTTCTCGAGAAATAGTGGCCCAGCACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134046.5-1267s21c1
Sequence:CCGGTTGCTGTCGTTCACCTATAAACTCGAGTTTATAGGTGAACGACAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134046.5-783s21c1
Sequence:CCGGACTGCGGCAACAACGAGATAACTCGAGTTATCTCGTTGTTGCCGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134046.5-695s21c1
Sequence:CCGGTAGAGGCTCAAACGAACATATCTCGAGATATGTTCGTTTGAGCCTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_134046.3-701s1c1
Sequence:CCGGGCTCAAACGAACATATCGAATCTCGAGATTCGATATGTTCGTTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_134046.3-1359s1c1
Sequence:CCGGCCACGAATGTCACTGTGACAACTCGAGTTGTCACAGTGACATTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134046.3-702s1c1
Sequence:CCGGCTCAAACGAACATATCGAATACTCGAGTATTCGATATGTTCGTTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134046.3-1147s1c1
Sequence:CCGGCCTGTTTAGACTCTGGGAATACTCGAGTATTCCCAGAGTCTAAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134046
VALIDATED
CENPO MISSION shRNA Lentiviral Transduction Particles
centromere protein O
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000329468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_134046.5-1146s21c1
Sequence:CCGGCCTGTTTAGACTCTGGGAATACTCGAGTATTCCCAGAGTCTAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329403    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_134046.5-1956s21c1
Sequence:CCGGGCATGTGCTGGGCCACTATTTCTCGAGAAATAGTGGCCCAGCACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134046.5-1267s21c1
Sequence:CCGGTTGCTGTCGTTCACCTATAAACTCGAGTTTATAGGTGAACGACAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134046.5-783s21c1
Sequence:CCGGACTGCGGCAACAACGAGATAACTCGAGTTATCTCGTTGTTGCCGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134046.5-695s21c1
Sequence:CCGGTAGAGGCTCAAACGAACATATCTCGAGATATGTTCGTTTGAGCCTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_134046.3-701s1c1
Sequence:CCGGGCTCAAACGAACATATCGAATCTCGAGATTCGATATGTTCGTTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_134046.3-1359s1c1
Sequence:CCGGCCACGAATGTCACTGTGACAACTCGAGTTGTCACAGTGACATTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134046.3-702s1c1
Sequence:CCGGCTCAAACGAACATATCGAATACTCGAGTATTCGATATGTTCGTTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134046.3-1147s1c1
Sequence:CCGGCCTGTTTAGACTCTGGGAATACTCGAGTATTCCCAGAGTCTAAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024322
VALIDATED
CENPO MISSION shRNA Bacterial Glycerol Stock
centromere protein O
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000291697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024322.1-342s21c1
Sequence:CCGGGCCAGCGTGAAAGCATGTATTCTCGAGAATACATGCTTTCACGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024322.1-758s21c1
Sequence:CCGGGCAGAGAAACCCACTGTGTAACTCGAGTTACACAGTGGGTTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024322.1-364s21c1
Sequence:CCGGCCAATGTAGAACCCAACCAAACTCGAGTTTGGTTGGGTTCTACATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307743    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024322.1-1497s21c1
Sequence:CCGGGCTCACACATCCACGAACAAACTCGAGTTTGTTCGTGGATGTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024322.1-758s1c1
Sequence:CCGGGCAGAGAAACCCACTGTGTAACTCGAGTTACACAGTGGGTTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072753    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024322.1-1497s1c1
Sequence:CCGGGCTCACACATCCACGAACAAACTCGAGTTTGTTCGTGGATGTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_024322.1-364s1c1
Sequence:CCGGCCAATGTAGAACCCAACCAAACTCGAGTTTGGTTGGGTTCTACATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024322.1-342s1c1
Sequence:CCGGGCCAGCGTGAAAGCATGTATTCTCGAGAATACATGCTTTCACGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024322.1-348s1c1
Sequence:CCGGGTGAAAGCATGTATTGCCAATCTCGAGATTGGCAATACATGCTTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024322
VALIDATED
CENPO MISSION shRNA shRNA Plasmid DNA
centromere protein O
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000291697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024322.1-342s21c1
Sequence:CCGGGCCAGCGTGAAAGCATGTATTCTCGAGAATACATGCTTTCACGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024322.1-758s21c1
Sequence:CCGGGCAGAGAAACCCACTGTGTAACTCGAGTTACACAGTGGGTTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024322.1-364s21c1
Sequence:CCGGCCAATGTAGAACCCAACCAAACTCGAGTTTGGTTGGGTTCTACATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307743    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024322.1-1497s21c1
Sequence:CCGGGCTCACACATCCACGAACAAACTCGAGTTTGTTCGTGGATGTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024322.1-758s1c1
Sequence:CCGGGCAGAGAAACCCACTGTGTAACTCGAGTTACACAGTGGGTTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072753    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024322.1-1497s1c1
Sequence:CCGGGCTCACACATCCACGAACAAACTCGAGTTTGTTCGTGGATGTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_024322.1-364s1c1
Sequence:CCGGCCAATGTAGAACCCAACCAAACTCGAGTTTGGTTGGGTTCTACATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024322.1-342s1c1
Sequence:CCGGGCCAGCGTGAAAGCATGTATTCTCGAGAATACATGCTTTCACGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024322.1-348s1c1
Sequence:CCGGGTGAAAGCATGTATTGCCAATCTCGAGATTGGCAATACATGCTTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024322
VALIDATED
CENPO MISSION shRNA Lentiviral Transduction Particles
centromere protein O
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000291697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024322.1-342s21c1
Sequence:CCGGGCCAGCGTGAAAGCATGTATTCTCGAGAATACATGCTTTCACGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024322.1-758s21c1
Sequence:CCGGGCAGAGAAACCCACTGTGTAACTCGAGTTACACAGTGGGTTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024322.1-364s21c1
Sequence:CCGGCCAATGTAGAACCCAACCAAACTCGAGTTTGGTTGGGTTCTACATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307743    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024322.1-1497s21c1
Sequence:CCGGGCTCACACATCCACGAACAAACTCGAGTTTGTTCGTGGATGTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024322.1-758s1c1
Sequence:CCGGGCAGAGAAACCCACTGTGTAACTCGAGTTACACAGTGGGTTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072753    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024322.1-1497s1c1
Sequence:CCGGGCTCACACATCCACGAACAAACTCGAGTTTGTTCGTGGATGTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_024322.1-364s1c1
Sequence:CCGGCCAATGTAGAACCCAACCAAACTCGAGTTTGGTTGGGTTCTACATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024322.1-342s1c1
Sequence:CCGGGCCAGCGTGAAAGCATGTATTCTCGAGAATACATGCTTTCACGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024322.1-348s1c1
Sequence:CCGGGTGAAAGCATGTATTGCCAATCTCGAGATTGGCAATACATGCTTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks