EMAIL THIS PAGE TO A FRIEND

CENPP

centromere protein P

54 Gene Product Result for
Synonyms: CENP-P
UniProtKB ID: Q6IPU0, B3KS17, Q5T9F8, Q5T9F9
Gene ID:
Human(401541) Summary: CENPP is a subunit of a CENPH (MIM 605607)-CENPI (MIM 300065)-associated centromeric complex that targets CENPA (MIM 117139) to centromeres and is required for proper kinetochore function and mitotic progression (Okada et al., 2006 [PubMed 16622420]
Mouse(66336) centromere protein P
Rat(685977) centromere protein P
Zebrafish(445161) centromere protein P
chicken(415952) centromere protein P
cow(504630) centromere protein P
domestic cat(101091409) centromere protein P
dog(476360) centromere protein P
sheep(101109147) centromere protein P
domestic guinea pig(100723634) centromere protein P
naked mole-rat(101697982) centromere protein P
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025495 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025495 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025495 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001012267 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001012267 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001012267 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU036311 MISSION® esiRNA esiRNA targeting mouse Cenpp (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012267 Rosetta Predictions human pricing
NM_025495 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012267 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00201248 predicted 874
2 SASI_Hs01_00201249 predicted 1082
3 SASI_Hs01_00201250 predicted 863
4 SASI_Hs01_00201251 predicted 893
5 SASI_Hs01_00201252 predicted 752
6 SASI_Hs01_00201253 predicted 866
7 SASI_Hs01_00201254 predicted 628
8 SASI_Hs01_00201255 predicted 757
9 SASI_Hs01_00201256 predicted 796
10 SASI_Hs02_00306058 predicted 792
11 SASI_Hs01_00201247 predicted 1198
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025495 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00098313 predicted 686
2 SASI_Mm01_00098314 predicted 604
3 SASI_Mm01_00098315 predicted 228
4 SASI_Mm01_00098317 predicted 377
5 SASI_Mm01_00098318 predicted 612
6 SASI_Mm01_00098319 predicted 674
7 SASI_Mm01_00098320 predicted 204
8 SASI_Mm02_00328370 predicted 569
9 SASI_Mm01_00098321 predicted 250
10 SASI_Mm01_00098322 predicted 387
11 SASI_Mm01_00098316 predicted 493
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025495
VALIDATED
CENPP MISSION shRNA Bacterial Glycerol Stock
centromere protein P
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000181318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025495.1-616s1c1
Sequence:CCGGCCCAGATACTGTATACCTCTTCTCGAGAAGAGGTATACAGTATCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025495.1-258s1c1
Sequence:CCGGGTAAACTTACTGGCTTCAATACTCGAGTATTGAAGCCAGTAAGTTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025495.1-291s1c1
Sequence:CCGGCCAAGATGGAAGACATTGTAACTCGAGTTACAATGTCTTCCATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200232    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025495.1-145s1c1
Sequence:CCGGCGGAGCCTGGAAATCATTTCACTCGAGTGAAATGATTTCCAGGCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025495.1-147s1c1
Sequence:CCGGGAGCCTGGAAATCATTTCAAACTCGAGTTTGAAATGATTTCCAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025495.1-581s1c1
Sequence:CCGGCGTGAGAACACATTTAAGCATCTCGAGATGCTTAAATGTGTTCTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217114    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025495.3-862s1c1
Sequence:CCGGCTAGACAGCCTGATAAGATTGCTCGAGCAATCTTATCAGGCTGTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025495
VALIDATED
CENPP MISSION shRNA shRNA Plasmid DNA
centromere protein P
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000181318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025495.1-616s1c1
Sequence:CCGGCCCAGATACTGTATACCTCTTCTCGAGAAGAGGTATACAGTATCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025495.1-258s1c1
Sequence:CCGGGTAAACTTACTGGCTTCAATACTCGAGTATTGAAGCCAGTAAGTTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025495.1-291s1c1
Sequence:CCGGCCAAGATGGAAGACATTGTAACTCGAGTTACAATGTCTTCCATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200232    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025495.1-145s1c1
Sequence:CCGGCGGAGCCTGGAAATCATTTCACTCGAGTGAAATGATTTCCAGGCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025495.1-147s1c1
Sequence:CCGGGAGCCTGGAAATCATTTCAAACTCGAGTTTGAAATGATTTCCAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025495.1-581s1c1
Sequence:CCGGCGTGAGAACACATTTAAGCATCTCGAGATGCTTAAATGTGTTCTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217114    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025495.3-862s1c1
Sequence:CCGGCTAGACAGCCTGATAAGATTGCTCGAGCAATCTTATCAGGCTGTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025495
VALIDATED
CENPP MISSION shRNA Lentiviral Transduction Particles
centromere protein P
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000181318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025495.1-616s1c1
Sequence:CCGGCCCAGATACTGTATACCTCTTCTCGAGAAGAGGTATACAGTATCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025495.1-258s1c1
Sequence:CCGGGTAAACTTACTGGCTTCAATACTCGAGTATTGAAGCCAGTAAGTTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025495.1-291s1c1
Sequence:CCGGCCAAGATGGAAGACATTGTAACTCGAGTTACAATGTCTTCCATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200232    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025495.1-145s1c1
Sequence:CCGGCGGAGCCTGGAAATCATTTCACTCGAGTGAAATGATTTCCAGGCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025495.1-147s1c1
Sequence:CCGGGAGCCTGGAAATCATTTCAAACTCGAGTTTGAAATGATTTCCAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025495.1-581s1c1
Sequence:CCGGCGTGAGAACACATTTAAGCATCTCGAGATGCTTAAATGTGTTCTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217114    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025495.3-862s1c1
Sequence:CCGGCTAGACAGCCTGATAAGATTGCTCGAGCAATCTTATCAGGCTGTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001012267
CENPP MISSION shRNA Bacterial Glycerol Stock
centromere protein P
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172528    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012267.1-1349s1c1
Sequence:CCGGGAATCGAAGCTGCTCTGGAAACTCGAGTTTCCAGAGCAGCTTCGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172423    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012267.1-2026s1c1
Sequence:CCGGCGCAAGGAATGAGGTCCTTTACTCGAGTAAAGGACCTCATTCCTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168649    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012267.1-1083s1c1
Sequence:CCGGGCGCACGTTTAAACATCTCAACTCGAGTTGAGATGTTTAAACGTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168703    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012267.1-2027s1c1
Sequence:CCGGGCAAGGAATGAGGTCCTTTATCTCGAGATAAAGGACCTCATTCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168413    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012267.1-752s1c1
Sequence:CCGGGTACGCTTACTGGCATCAATACTCGAGTATTGATGCCAGTAAGCGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012267.1-1197s21c1
Sequence:CCGGCATTGTTTGGAGGATACAAATCTCGAGATTTGTATCCTCCAAACAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012267.1-942s21c1
Sequence:CCGGTGTTACTGACCTCAACATAATCTCGAGATTATGTTGAGGTCAGTAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001012267
CENPP MISSION shRNA shRNA Plasmid DNA
centromere protein P
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172528    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012267.1-1349s1c1
Sequence:CCGGGAATCGAAGCTGCTCTGGAAACTCGAGTTTCCAGAGCAGCTTCGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172423    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012267.1-2026s1c1
Sequence:CCGGCGCAAGGAATGAGGTCCTTTACTCGAGTAAAGGACCTCATTCCTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168649    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012267.1-1083s1c1
Sequence:CCGGGCGCACGTTTAAACATCTCAACTCGAGTTGAGATGTTTAAACGTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168703    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012267.1-2027s1c1
Sequence:CCGGGCAAGGAATGAGGTCCTTTATCTCGAGATAAAGGACCTCATTCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168413    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012267.1-752s1c1
Sequence:CCGGGTACGCTTACTGGCATCAATACTCGAGTATTGATGCCAGTAAGCGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012267.1-1197s21c1
Sequence:CCGGCATTGTTTGGAGGATACAAATCTCGAGATTTGTATCCTCCAAACAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012267.1-942s21c1
Sequence:CCGGTGTTACTGACCTCAACATAATCTCGAGATTATGTTGAGGTCAGTAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001012267
CENPP MISSION shRNA Lentiviral Transduction Particles
centromere protein P
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172528    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012267.1-1349s1c1
Sequence:CCGGGAATCGAAGCTGCTCTGGAAACTCGAGTTTCCAGAGCAGCTTCGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172423    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012267.1-2026s1c1
Sequence:CCGGCGCAAGGAATGAGGTCCTTTACTCGAGTAAAGGACCTCATTCCTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168649    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012267.1-1083s1c1
Sequence:CCGGGCGCACGTTTAAACATCTCAACTCGAGTTGAGATGTTTAAACGTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168703    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012267.1-2027s1c1
Sequence:CCGGGCAAGGAATGAGGTCCTTTATCTCGAGATAAAGGACCTCATTCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168413    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012267.1-752s1c1
Sequence:CCGGGTACGCTTACTGGCATCAATACTCGAGTATTGATGCCAGTAAGCGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012267.1-1197s21c1
Sequence:CCGGCATTGTTTGGAGGATACAAATCTCGAGATTTGTATCCTCCAAACAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012267.1-942s21c1
Sequence:CCGGTGTTACTGACCTCAACATAATCTCGAGATTATGTTGAGGTCAGTAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks