EMAIL THIS PAGE TO A FRIEND

CENPT

centromere protein T

96 Gene Product Result for
Synonyms: C16orf56 CENP-T
UniProtKB ID: Q96BT3, Q96I29, Q96IC6, Q96NK9, Q9H901
Gene ID:
Human(80152) Summary: The centromere is a specialized chromatin domain, present throughout the cell cycle, that acts as a platform on which the transient assembly of the kinetochore occurs during mitosis. All active centromeres are characterized by the presence of long arrays of nucleosomes in which CENPA (MIM 117139) replaces histone H3 (see MIM 601128). CENPT is an additional factor required for centromere assembly (Foltz et al., 2006 [PubMed 16622419]
Mouse(320394) centromere protein T
Rat(307805) centromere protein T
chicken(415654) centromere protein T
dog(611127) centromere protein T
cow(513195) centromere protein T
domestic cat(101080929) centromere protein T
sheep(101115894) centromere protein T
domestic guinea pig(100728816) centromere protein T
naked mole-rat(101703103) centromere protein T
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177150 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177150 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177150 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_025082 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025082 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025082 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025082 Rosetta Predictions human pricing
NM_001024257 Rosetta Predictions rat pricing
NM_177150 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025082 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00357777 predicted 2030
2 SASI_Hs02_00357778 predicted 1766
3 SASI_Hs01_00088900 predicted 1016
4 SASI_Hs02_00357779 predicted 1919
5 SASI_Hs02_00357780 predicted 2067
6 SASI_Hs01_00088904 predicted 892
7 SASI_Hs01_00088906 predicted 783
8 SASI_Hs01_00088907 predicted 1514
9 SASI_Hs02_00357781 predicted 2037
10 SASI_Hs02_00357782 predicted 1925
11 SASI_Hs01_00088899 predicted 1220
12 SASI_Hs01_00088901 predicted 561
13 SASI_Hs01_00088902 predicted 1284
14 SASI_Hs01_00088903 predicted 942
15 SASI_Hs01_00088905 predicted 415
16 SASI_Hs01_00088908 predicted 1318
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024257 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00099993 predicted 1008
2 SASI_Rn01_00099994 predicted 1094
3 SASI_Rn02_00202418 predicted 486
4 SASI_Rn01_00099995 predicted 1357
5 SASI_Rn01_00099997 predicted 1323
6 SASI_Rn01_00099999 predicted 1024
7 SASI_Rn01_00100000 predicted 1396
8 SASI_Rn02_00202419 predicted 487
9 SASI_Rn01_00100001 predicted 302
10 SASI_Rn01_00100002 predicted 1315
11 SASI_Rn01_00099996 predicted 1396
12 SASI_Rn01_00099998 predicted 705
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177150 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00189793 predicted 1518
2 SASI_Mm01_00189794 predicted 482
3 SASI_Mm01_00189795 predicted 1398
4 SASI_Mm01_00189796 predicted 920
5 SASI_Mm01_00189797 predicted 1294
6 SASI_Mm01_00189798 predicted 1391
7 SASI_Mm01_00189799 predicted 1534
8 SASI_Mm01_00189800 predicted 594
9 SASI_Mm01_00189801 predicted 1518
10 SASI_Mm01_00189802 predicted 572
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177150
VALIDATED
CENPT MISSION shRNA Bacterial Glycerol Stock
centromere protein T
Mouse
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202210    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177150.1-287s1c1
Sequence:CCGGCCGGACTCTGCTAAGGAATATCTCGAGATATTCCTTAGCAGAGTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201028    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177150.1-1607s1c1
Sequence:CCGGCCTTGGAAATCTTGAACCCTACTCGAGTAGGGTTCAAGATTTCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201116    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177150.1-130s1c1
Sequence:CCGGCTCGGATCAATGCACAAAGAACTCGAGTTCTTTGTGCATTGATCCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177150.1-569s1c1
Sequence:CCGGGAGTGCTGATGTTTCATCCTTCTCGAGAAGGATGAAACATCAGCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192080    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177150.1-1602s1c1
Sequence:CCGGCCCTACCTTGGAAATCTTGAACTCGAGTTCAAGATTTCCAAGGTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177150.1-1286s1c1
Sequence:CCGGCTTCAGCTTCTGTACTAAGATCTCGAGATCTTAGTACAGAAGCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177150.1-141s1c1
Sequence:CCGGGCACAAAGAAGACGGTCTCAACTCGAGTTGAGACCGTCTTCTTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177150.2-1533s21c1
Sequence:CCGGCTTGTGCATTCAGTGGCAATTCTCGAGAATTGCCACTGAATGCACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215613    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177150.2-493s1c1
Sequence:CCGGGAAACTGAGATTATCAGTATTCTCGAGAATACTGATAATCTCAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279010    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177150.2-1601s21c1
Sequence:CCGGCCCTACCTTGGAAATCTTGAACTCGAGTTCAAGATTTCCAAGGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177150.2-1395s21c1
Sequence:CCGGCTCATGCTGGCCGTAAGATTGCTCGAGCAATCTTACGGCCAGCATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177150.2-1087s21c1
Sequence:CCGGGCCAGCAAGTGGAGAATTATCCTCGAGGATAATTCTCCACTTGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177150.2-1339s21c1
Sequence:CCGGGAAGTGCCTAGACAAGTATTTCTCGAGAAATACTTGTCTAGGCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177150.2-1285s21c1
Sequence:CCGGCTTCAGCTTCTGTACTAAGATCTCGAGATCTTAGTACAGAAGCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177150.2-285s21c1
Sequence:CCGGCCCGGACTCTGCTAAGGAATACTCGAGTATTCCTTAGCAGAGTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177150
VALIDATED
CENPT MISSION shRNA shRNA Plasmid DNA
centromere protein T
Mouse
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202210    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177150.1-287s1c1
Sequence:CCGGCCGGACTCTGCTAAGGAATATCTCGAGATATTCCTTAGCAGAGTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201028    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177150.1-1607s1c1
Sequence:CCGGCCTTGGAAATCTTGAACCCTACTCGAGTAGGGTTCAAGATTTCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201116    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177150.1-130s1c1
Sequence:CCGGCTCGGATCAATGCACAAAGAACTCGAGTTCTTTGTGCATTGATCCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177150.1-569s1c1
Sequence:CCGGGAGTGCTGATGTTTCATCCTTCTCGAGAAGGATGAAACATCAGCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192080    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177150.1-1602s1c1
Sequence:CCGGCCCTACCTTGGAAATCTTGAACTCGAGTTCAAGATTTCCAAGGTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177150.1-1286s1c1
Sequence:CCGGCTTCAGCTTCTGTACTAAGATCTCGAGATCTTAGTACAGAAGCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177150.1-141s1c1
Sequence:CCGGGCACAAAGAAGACGGTCTCAACTCGAGTTGAGACCGTCTTCTTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177150.2-1533s21c1
Sequence:CCGGCTTGTGCATTCAGTGGCAATTCTCGAGAATTGCCACTGAATGCACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215613    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177150.2-493s1c1
Sequence:CCGGGAAACTGAGATTATCAGTATTCTCGAGAATACTGATAATCTCAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279010    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177150.2-1601s21c1
Sequence:CCGGCCCTACCTTGGAAATCTTGAACTCGAGTTCAAGATTTCCAAGGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177150.2-1395s21c1
Sequence:CCGGCTCATGCTGGCCGTAAGATTGCTCGAGCAATCTTACGGCCAGCATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177150.2-1087s21c1
Sequence:CCGGGCCAGCAAGTGGAGAATTATCCTCGAGGATAATTCTCCACTTGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177150.2-1339s21c1
Sequence:CCGGGAAGTGCCTAGACAAGTATTTCTCGAGAAATACTTGTCTAGGCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177150.2-1285s21c1
Sequence:CCGGCTTCAGCTTCTGTACTAAGATCTCGAGATCTTAGTACAGAAGCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177150.2-285s21c1
Sequence:CCGGCCCGGACTCTGCTAAGGAATACTCGAGTATTCCTTAGCAGAGTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177150
VALIDATED
CENPT MISSION shRNA Lentiviral Transduction Particles
centromere protein T
Mouse
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202210    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177150.1-287s1c1
Sequence:CCGGCCGGACTCTGCTAAGGAATATCTCGAGATATTCCTTAGCAGAGTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201028    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177150.1-1607s1c1
Sequence:CCGGCCTTGGAAATCTTGAACCCTACTCGAGTAGGGTTCAAGATTTCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201116    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177150.1-130s1c1
Sequence:CCGGCTCGGATCAATGCACAAAGAACTCGAGTTCTTTGTGCATTGATCCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177150.1-569s1c1
Sequence:CCGGGAGTGCTGATGTTTCATCCTTCTCGAGAAGGATGAAACATCAGCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192080    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177150.1-1602s1c1
Sequence:CCGGCCCTACCTTGGAAATCTTGAACTCGAGTTCAAGATTTCCAAGGTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177150.1-1286s1c1
Sequence:CCGGCTTCAGCTTCTGTACTAAGATCTCGAGATCTTAGTACAGAAGCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177150.1-141s1c1
Sequence:CCGGGCACAAAGAAGACGGTCTCAACTCGAGTTGAGACCGTCTTCTTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177150.2-1533s21c1
Sequence:CCGGCTTGTGCATTCAGTGGCAATTCTCGAGAATTGCCACTGAATGCACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215613    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177150.2-493s1c1
Sequence:CCGGGAAACTGAGATTATCAGTATTCTCGAGAATACTGATAATCTCAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279010    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177150.2-1601s21c1
Sequence:CCGGCCCTACCTTGGAAATCTTGAACTCGAGTTCAAGATTTCCAAGGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177150.2-1395s21c1
Sequence:CCGGCTCATGCTGGCCGTAAGATTGCTCGAGCAATCTTACGGCCAGCATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177150.2-1087s21c1
Sequence:CCGGGCCAGCAAGTGGAGAATTATCCTCGAGGATAATTCTCCACTTGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177150.2-1339s21c1
Sequence:CCGGGAAGTGCCTAGACAAGTATTTCTCGAGAAATACTTGTCTAGGCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177150.2-1285s21c1
Sequence:CCGGCTTCAGCTTCTGTACTAAGATCTCGAGATCTTAGTACAGAAGCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177150.2-285s21c1
Sequence:CCGGCCCGGACTCTGCTAAGGAATACTCGAGTATTCCTTAGCAGAGTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025082
VALIDATED
CENPT MISSION shRNA Bacterial Glycerol Stock
centromere protein T
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166061    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025082.1-333s1c1
Sequence:CCGGGAATCTTCCATCCTGATGCCTCTCGAGAGGCATCAGGATGGAAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161790    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025082.1-303s1c1
Sequence:CCGGCTGCTGAAGAACATCCTACTACTCGAGTAGTAGGATGTTCTTCAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159720    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025082.1-1721s1c1
Sequence:CCGGGCCACTATGTGAAACTCTTTACTCGAGTAAAGAGTTTCACATAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159134    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025082.1-946s1c1
Sequence:CCGGGAGAGTTGACAATGGTAGTTTCTCGAGAAACTACCATTGTCAACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159170    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025082.1-1729s1c1
Sequence:CCGGGTGAAACTCTTTAGCTTCTATCTCGAGATAGAAGCTAAAGAGTTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161320    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025082.1-1297s1c1
Sequence:CCGGGAAGATGAAGTAGAGCCCTTACTCGAGTAAGGGCTCTACTTCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_025082.1-890s1c1
Sequence:CCGGGCAGAAGAATAGTGAGTGTGTCTCGAGACACACTCACTATTCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_025082.1-506s1c1
Sequence:CCGGGCTGAGACTGTCAGTGTTTCACTCGAGTGAAACACTGACAGTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165631    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025082.1-302s1c1
Sequence:CCGGGCTGCTGAAGAACATCCTACTCTCGAGAGTAGGATGTTCTTCAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164846    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025082.1-1831s1c1
Sequence:CCGGCTGGAGGTATTTGCTGCTCATCTCGAGATGAGCAGCAAATACCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025082.3-1215s21c1
Sequence:CCGGTTTGCGGGATCTGCGAGATACCTCGAGGTATCTCGCAGATCCCGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025082.3-1997s21c1
Sequence:CCGGTGGAGAAGTGCCTAGATAAATCTCGAGATTTATCTAGGCACTTCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025082.3-1017s21c1
Sequence:CCGGGCTGAGACTGTCAGTGTTTCACTCGAGTGAAACACTGACAGTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025082.3-816s21c1
Sequence:CCGGGCTGAAGAACATCCTACTAACCTCGAGGTTAGTAGGATGTTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025082.3-754s21c1
Sequence:CCGGGTTGGCAGATCGGCCCATATTCTCGAGAATATGGGCCGATCTGCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025082
VALIDATED
CENPT MISSION shRNA shRNA Plasmid DNA
centromere protein T
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166061    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025082.1-333s1c1
Sequence:CCGGGAATCTTCCATCCTGATGCCTCTCGAGAGGCATCAGGATGGAAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161790    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025082.1-303s1c1
Sequence:CCGGCTGCTGAAGAACATCCTACTACTCGAGTAGTAGGATGTTCTTCAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159720    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025082.1-1721s1c1
Sequence:CCGGGCCACTATGTGAAACTCTTTACTCGAGTAAAGAGTTTCACATAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159134    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025082.1-946s1c1
Sequence:CCGGGAGAGTTGACAATGGTAGTTTCTCGAGAAACTACCATTGTCAACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159170    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025082.1-1729s1c1
Sequence:CCGGGTGAAACTCTTTAGCTTCTATCTCGAGATAGAAGCTAAAGAGTTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161320    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025082.1-1297s1c1
Sequence:CCGGGAAGATGAAGTAGAGCCCTTACTCGAGTAAGGGCTCTACTTCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_025082.1-890s1c1
Sequence:CCGGGCAGAAGAATAGTGAGTGTGTCTCGAGACACACTCACTATTCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_025082.1-506s1c1
Sequence:CCGGGCTGAGACTGTCAGTGTTTCACTCGAGTGAAACACTGACAGTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165631    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025082.1-302s1c1
Sequence:CCGGGCTGCTGAAGAACATCCTACTCTCGAGAGTAGGATGTTCTTCAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164846    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025082.1-1831s1c1
Sequence:CCGGCTGGAGGTATTTGCTGCTCATCTCGAGATGAGCAGCAAATACCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025082.3-1215s21c1
Sequence:CCGGTTTGCGGGATCTGCGAGATACCTCGAGGTATCTCGCAGATCCCGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025082.3-1997s21c1
Sequence:CCGGTGGAGAAGTGCCTAGATAAATCTCGAGATTTATCTAGGCACTTCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025082.3-1017s21c1
Sequence:CCGGGCTGAGACTGTCAGTGTTTCACTCGAGTGAAACACTGACAGTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025082.3-816s21c1
Sequence:CCGGGCTGAAGAACATCCTACTAACCTCGAGGTTAGTAGGATGTTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025082.3-754s21c1
Sequence:CCGGGTTGGCAGATCGGCCCATATTCTCGAGAATATGGGCCGATCTGCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025082
VALIDATED
CENPT MISSION shRNA Lentiviral Transduction Particles
centromere protein T
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166061    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025082.1-333s1c1
Sequence:CCGGGAATCTTCCATCCTGATGCCTCTCGAGAGGCATCAGGATGGAAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161790    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025082.1-303s1c1
Sequence:CCGGCTGCTGAAGAACATCCTACTACTCGAGTAGTAGGATGTTCTTCAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159720    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025082.1-1721s1c1
Sequence:CCGGGCCACTATGTGAAACTCTTTACTCGAGTAAAGAGTTTCACATAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159134    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025082.1-946s1c1
Sequence:CCGGGAGAGTTGACAATGGTAGTTTCTCGAGAAACTACCATTGTCAACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159170    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025082.1-1729s1c1
Sequence:CCGGGTGAAACTCTTTAGCTTCTATCTCGAGATAGAAGCTAAAGAGTTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161320    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025082.1-1297s1c1
Sequence:CCGGGAAGATGAAGTAGAGCCCTTACTCGAGTAAGGGCTCTACTTCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_025082.1-890s1c1
Sequence:CCGGGCAGAAGAATAGTGAGTGTGTCTCGAGACACACTCACTATTCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_025082.1-506s1c1
Sequence:CCGGGCTGAGACTGTCAGTGTTTCACTCGAGTGAAACACTGACAGTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165631    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025082.1-302s1c1
Sequence:CCGGGCTGCTGAAGAACATCCTACTCTCGAGAGTAGGATGTTCTTCAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164846    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025082.1-1831s1c1
Sequence:CCGGCTGGAGGTATTTGCTGCTCATCTCGAGATGAGCAGCAAATACCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025082.3-1215s21c1
Sequence:CCGGTTTGCGGGATCTGCGAGATACCTCGAGGTATCTCGCAGATCCCGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025082.3-1997s21c1
Sequence:CCGGTGGAGAAGTGCCTAGATAAATCTCGAGATTTATCTAGGCACTTCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025082.3-1017s21c1
Sequence:CCGGGCTGAGACTGTCAGTGTTTCACTCGAGTGAAACACTGACAGTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025082.3-816s21c1
Sequence:CCGGGCTGAAGAACATCCTACTAACCTCGAGGTTAGTAGGATGTTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025082.3-754s21c1
Sequence:CCGGGTTGGCAGATCGGCCCATATTCTCGAGAATATGGGCCGATCTGCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks