EMAIL THIS PAGE TO A FRIEND

CENPV

centromere protein V

112 Gene Product Result for
Synonyms: 3110013H01Rik CENP-V PRR6 p30
UniProtKB ID: Q7Z7K6, B2RPK2, Q3L8N5, Q8NFH6
Gene ID:
Mouse(73139) centromere protein V
Rat(501702) centromere protein V
naked mole-rat(101703843) centromere protein V
domestic guinea pig(100728684) centromere protein V
sheep(101107207) centromere protein V
Zebrafish(100334010) centromere protein V
chicken(417601) centromere protein V
cow(521064) centromere protein V
domestic cat(101094460) centromere protein V
dog(489523) centromere protein V
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181716 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181716 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181716 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028448 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028448 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028448 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU144881 MISSION® esiRNA esiRNA human CENPV (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181716 Rosetta Predictions human pricing
XM_577104 Rosetta Predictions rat pricing
XR_009193 Rosetta Predictions rat pricing
XM_203393 Rosetta Predictions mouse pricing
XM_901425 Rosetta Predictions mouse pricing
XM_901429 Rosetta Predictions mouse pricing
XM_916747 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181716 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00185268 predicted 683
2 SASI_Hs01_00185269 predicted 631
3 SASI_Hs02_00370325 predicted 822
4 SASI_Hs01_00185271 predicted 653
5 SASI_Hs01_00185273 predicted 816
6 SASI_Hs01_00185274 predicted 805
7 SASI_Hs01_00185275 predicted 592
8 SASI_Hs01_00185276 predicted 719
9 SASI_Hs01_00185277 predicted 853
10 SASI_Hs02_00370326 predicted 712
11 SASI_Hs01_00185270 predicted 660
12 SASI_Hs01_00185272 predicted 601
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_577104 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00406183 predicted 900
2 SASI_Rn02_00406184 predicted 630
3 SASI_Rn02_00406185 predicted 768
4 SASI_Rn02_00406186 predicted 934
5 SASI_Rn02_00406187 predicted 680
6 SASI_Rn02_00406188 predicted 713
7 SASI_Rn02_00406189 predicted 764
8 SASI_Rn02_00406190 predicted 668
9 SASI_Rn02_00406191 predicted 731
10 SASI_Rn02_00406192 predicted 700
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_009193 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00174428 predicted 951
2 SASI_Rn01_00174429 predicted 672
3 SASI_Rn01_00174430 predicted 810
4 SASI_Rn01_00174431 predicted 985
5 SASI_Rn01_00174432 predicted 724
6 SASI_Rn01_00174433 predicted 760
7 SASI_Rn01_00174434 predicted 816
8 SASI_Rn01_00174435 predicted 714
9 SASI_Rn01_00174436 predicted 772
10 SASI_Rn01_00174437 predicted 746
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_203393 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00235592 predicted 473
2 SASI_Mm01_00235593 predicted 633
3 SASI_Mm01_00235596 predicted 565
4 SASI_Mm02_00425521 predicted 575
5 SASI_Mm01_00235597 predicted 575
6 SASI_Mm02_00425522 predicted 465
7 SASI_Mm01_00235598 predicted 534
8 SASI_Mm02_00425523 predicted 572
9 SASI_Mm01_00235600 predicted 616
10 SASI_Mm01_00235601 predicted 494
11 SASI_Mm01_00235594 predicted 825
12 SASI_Mm01_00235595 predicted 792
13 SASI_Mm01_00235599 predicted 528
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901425 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00206063 predicted 356
2 SASI_Mm01_00206064 predicted 287
3 SASI_Mm01_00206065 predicted 510
4 SASI_Mm01_00206066 predicted 291
5 SASI_Mm01_00206067 predicted 302
6 SASI_Mm01_00206068 predicted 334
7 SASI_Mm01_00206069 predicted 353
8 SASI_Mm01_00206070 predicted 268
9 SASI_Mm01_00206071 predicted 311
10 SASI_Mm01_00206072 predicted 482
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901429 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00224807 predicted 765
2 SASI_Mm01_00224808 predicted 668
3 SASI_Mm01_00224809 predicted 915
4 SASI_Mm01_00224810 predicted 1105
5 SASI_Mm01_00224811 predicted 1066
6 SASI_Mm01_00224812 predicted 854
7 SASI_Mm01_00224813 predicted 856
8 SASI_Mm01_00224814 predicted 812
9 SASI_Mm01_00224815 predicted 806
10 SASI_Mm01_00224816 predicted 900
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_916747 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00440580 predicted 471
2 SASI_Mm02_00440581 predicted 636
3 SASI_Mm02_00440582 predicted 818
4 SASI_Mm02_00440583 predicted 780
5 SASI_Mm02_00440584 predicted 567
6 SASI_Mm02_00440585 predicted 577
7 SASI_Mm02_00440586 predicted 527
8 SASI_Mm02_00440587 predicted 573
9 SASI_Mm02_00440588 predicted 623
10 SASI_Mm02_00440589 predicted 494
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181716
VALIDATED
CENPV MISSION shRNA Bacterial Glycerol Stock
centromere protein V
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000426261    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181716.2-1021s21c1
Sequence:CCGGAGTTTGCTCCAGCTACCAGTTCTCGAGAACTGGTAGCTGGAGCAAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181716.2-562s21c1
Sequence:CCGGTTGACTGCAATTGCAGCATTTCTCGAGAAATGCTGCAATTGCAGTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000131239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_181716.1-550s1c1
Sequence:CCGGGCCTCAGCAGACTTGCATATACTCGAGTATATGCAAGTCTGCTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000131045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_181716.1-681s1c1
Sequence:CCGGCAATACTCACAAAGCCCAGCACTCGAGTGCTGGGCTTTGTGAGTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_181716.1-697s1c1
Sequence:CCGGCAGCATACCTTCTGTAAGAGACTCGAGTCTCTTACAGAAGGTATGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_181716.1-849s1c1
Sequence:CCGGCATGAAAGAGCACAAGACCATCTCGAGATGGTCTTGTGCTCTTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_181716.1-660s1c1
Sequence:CCGGGCACATAACGACTTACACGTTCTCGAGAACGTGTAAGTCGTTATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181716
VALIDATED
CENPV MISSION shRNA shRNA Plasmid DNA
centromere protein V
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000426261    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181716.2-1021s21c1
Sequence:CCGGAGTTTGCTCCAGCTACCAGTTCTCGAGAACTGGTAGCTGGAGCAAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181716.2-562s21c1
Sequence:CCGGTTGACTGCAATTGCAGCATTTCTCGAGAAATGCTGCAATTGCAGTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000131239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_181716.1-550s1c1
Sequence:CCGGGCCTCAGCAGACTTGCATATACTCGAGTATATGCAAGTCTGCTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000131045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_181716.1-681s1c1
Sequence:CCGGCAATACTCACAAAGCCCAGCACTCGAGTGCTGGGCTTTGTGAGTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_181716.1-697s1c1
Sequence:CCGGCAGCATACCTTCTGTAAGAGACTCGAGTCTCTTACAGAAGGTATGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_181716.1-849s1c1
Sequence:CCGGCATGAAAGAGCACAAGACCATCTCGAGATGGTCTTGTGCTCTTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_181716.1-660s1c1
Sequence:CCGGGCACATAACGACTTACACGTTCTCGAGAACGTGTAAGTCGTTATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181716
VALIDATED
CENPV MISSION shRNA Lentiviral Transduction Particles
centromere protein V
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000426261    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181716.2-1021s21c1
Sequence:CCGGAGTTTGCTCCAGCTACCAGTTCTCGAGAACTGGTAGCTGGAGCAAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181716.2-562s21c1
Sequence:CCGGTTGACTGCAATTGCAGCATTTCTCGAGAAATGCTGCAATTGCAGTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000131239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_181716.1-550s1c1
Sequence:CCGGGCCTCAGCAGACTTGCATATACTCGAGTATATGCAAGTCTGCTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000131045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_181716.1-681s1c1
Sequence:CCGGCAATACTCACAAAGCCCAGCACTCGAGTGCTGGGCTTTGTGAGTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_181716.1-697s1c1
Sequence:CCGGCAGCATACCTTCTGTAAGAGACTCGAGTCTCTTACAGAAGGTATGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_181716.1-849s1c1
Sequence:CCGGCATGAAAGAGCACAAGACCATCTCGAGATGGTCTTGTGCTCTTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_181716.1-660s1c1
Sequence:CCGGGCACATAACGACTTACACGTTCTCGAGAACGTGTAAGTCGTTATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028448
VALIDATED
CENPV MISSION shRNA Bacterial Glycerol Stock
centromere protein V
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000341689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028448.1-643s21c1
Sequence:CCGGGTGGTGTCCAGAGCTTCTATACTCGAGTATAGAAGCTCTGGACACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028448.1-586s21c1
Sequence:CCGGGCATAACCACATACACCTTTACTCGAGTAAAGGTGTATGTGGTTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028448.1-496s21c1
Sequence:CCGGTTGACTGCAACTGTAGCATTTCTCGAGAAATGCTACAGTTGCAGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028448.1-469s21c1
Sequence:CCGGTTTGGGCTTCAGCAGACTTACCTCGAGGTAAGTCTGCTGAAGCCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341758    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028448.1-823s21c1
Sequence:CCGGAGTAGCCCTGTAGGTTGCATGCTCGAGCATGCAACCTACAGGGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028448
VALIDATED
CENPV MISSION shRNA shRNA Plasmid DNA
centromere protein V
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000341689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028448.1-643s21c1
Sequence:CCGGGTGGTGTCCAGAGCTTCTATACTCGAGTATAGAAGCTCTGGACACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028448.1-586s21c1
Sequence:CCGGGCATAACCACATACACCTTTACTCGAGTAAAGGTGTATGTGGTTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028448.1-496s21c1
Sequence:CCGGTTGACTGCAACTGTAGCATTTCTCGAGAAATGCTACAGTTGCAGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028448.1-469s21c1
Sequence:CCGGTTTGGGCTTCAGCAGACTTACCTCGAGGTAAGTCTGCTGAAGCCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341758    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028448.1-823s21c1
Sequence:CCGGAGTAGCCCTGTAGGTTGCATGCTCGAGCATGCAACCTACAGGGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028448
VALIDATED
CENPV MISSION shRNA Lentiviral Transduction Particles
centromere protein V
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000341689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028448.1-643s21c1
Sequence:CCGGGTGGTGTCCAGAGCTTCTATACTCGAGTATAGAAGCTCTGGACACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028448.1-586s21c1
Sequence:CCGGGCATAACCACATACACCTTTACTCGAGTAAAGGTGTATGTGGTTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028448.1-496s21c1
Sequence:CCGGTTGACTGCAACTGTAGCATTTCTCGAGAAATGCTACAGTTGCAGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028448.1-469s21c1
Sequence:CCGGTTTGGGCTTCAGCAGACTTACCTCGAGGTAAGTCTGCTGAAGCCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341758    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028448.1-823s21c1
Sequence:CCGGAGTAGCCCTGTAGGTTGCATGCTCGAGCATGCAACCTACAGGGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks