EMAIL THIS PAGE TO A FRIEND

CENPW

centromere protein W

Synonyms: C6orf173 CUG2
UniProtKB ID: Q5EE01, A6NIR0, A6NJC2
Gene ID:
Mouse(66311) centromere protein W
Rat(689399) centromere protein W
chicken(421716) centromere protein W
domestic cat(101084879) centromere protein W
cow(787125) centromere protein W
sheep(101117252) centromere protein W
domestic guinea pig(100719561) centromere protein W
naked mole-rat(101719577) centromere protein W
75 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001012507 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001012507 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001012507 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001109747 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001109747 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001109747 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012507 Rosetta Predictions human pricing
XM_001070657 Rosetta Predictions rat pricing
NM_001109747 Rosetta Predictions mouse pricing
XM_488549 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012507 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00173047 predicted 295
2 SASI_Hs01_00173048 predicted 242
3 SASI_Hs02_00306170 predicted 276
4 SASI_Hs01_00173049 predicted 271
5 SASI_Hs01_00173050 predicted 263
6 SASI_Hs01_00173051 predicted 242
7 SASI_Hs01_00173052 predicted 265
8 SASI_Hs01_00173054 predicted 206
9 SASI_Hs01_00173055 predicted 208
10 SASI_Hs01_00173056 predicted 216
11 SASI_Hs01_00173053 predicted 289
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070657 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00332363 predicted 324
2 SASI_Rn02_00332364 predicted 293
3 SASI_Rn02_00332365 predicted 268
4 SASI_Rn02_00332366 predicted 241
5 SASI_Rn02_00332367 predicted 275
6 SASI_Rn02_00332368 predicted 291
7 SASI_Rn02_00332369 predicted 244
8 SASI_Rn02_00332370 predicted 273
9 SASI_Rn02_00332371 predicted 241
10 SASI_Rn02_00332372 predicted 284
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109747 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00304224 predicted 547
2 SASI_Mm02_00304225 predicted 563
3 SASI_Mm02_00304226 predicted 336
4 SASI_Mm02_00304227 predicted 583
5 SASI_Mm02_00304228 predicted 460
6 SASI_Mm02_00304229 predicted 513
7 SASI_Mm02_00304230 predicted 246
8 SASI_Mm02_00304231 predicted 505
9 SASI_Mm02_00304232 predicted 563
10 SASI_Mm02_00304233 predicted 330
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_488549 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00219165 predicted 558
2 SASI_Mm01_00219166 predicted 576
3 SASI_Mm01_00219167 predicted 275
4 SASI_Mm01_00219168 predicted 337
5 SASI_Mm01_00219169 predicted 465
6 SASI_Mm01_00219170 predicted 512
7 SASI_Mm01_00219171 predicted 252
8 SASI_Mm01_00219172 predicted 563
9 SASI_Mm01_00219173 predicted 508
10 SASI_Mm01_00219174 predicted 456
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001012507
VALIDATED
CENPW MISSION shRNA Bacterial Glycerol Stock
centromere protein W
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001012507.1-270s1c1
Sequence:CCGGGTGACTTATTGGTCCATCTGACTCGAGTCAGATGGACCAATAAGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143488    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012507.1-213s1c1
Sequence:CCGGGCTTTCTAAAGCGAGTCTTCACTCGAGTGAAGACTCGCTTTAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001012507.1-181s1c1
Sequence:CCGGGAGGAAGCAGATAAAGCGGAACTCGAGTTCCGCTTTATCTGCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001012507.1-331s1c1
Sequence:CCGGGACAAACGCTTGTGCGAGTAACTCGAGTTACTCGCACAAGCGTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001012507.1-229s1c1
Sequence:CCGGCTTCAAGCGAAAGAAGCCTCACTCGAGTGAGGCTTCTTTCGCTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001012507.1-312s1c1
Sequence:CCGGGATTAGCAGAAGAGTCCAGGACTCGAGTCCTGGACTCTTCTGCTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001012507.1-245s1c1
Sequence:CCGGCCTCAACTTCGTCTGGAGAAACTCGAGTTTCTCCAGACGAAGTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122475    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012507.1-232s1c1
Sequence:CCGGCAAGCGAAAGAAGCCTCAACTCTCGAGAGTTGAGGCTTCTTTCGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001012507.1-345s1c1
Sequence:CCGGCGAGTAAATGTAGAGTCATTACTCGAGTAATGACTCTACATTTACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001012507.1-359s1c1
Sequence:CCGGGTCATTAACAAGGAGCATGTACTCGAGTACATGCTCCTTGTTAATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001012507.1-214s1c1
Sequence:CCGGCTTTCTAAAGCGAGTCTTCAACTCGAGTTGAAGACTCGCTTTAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144204    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012507.1-299s1c1
Sequence:CCGGCTGTTTGTTCATCGATTAGCACTCGAGTGCTAATCGATGAACAAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001012507
VALIDATED
CENPW MISSION shRNA shRNA Plasmid DNA
centromere protein W
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001012507.1-270s1c1
Sequence:CCGGGTGACTTATTGGTCCATCTGACTCGAGTCAGATGGACCAATAAGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143488    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012507.1-213s1c1
Sequence:CCGGGCTTTCTAAAGCGAGTCTTCACTCGAGTGAAGACTCGCTTTAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001012507.1-181s1c1
Sequence:CCGGGAGGAAGCAGATAAAGCGGAACTCGAGTTCCGCTTTATCTGCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001012507.1-331s1c1
Sequence:CCGGGACAAACGCTTGTGCGAGTAACTCGAGTTACTCGCACAAGCGTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001012507.1-229s1c1
Sequence:CCGGCTTCAAGCGAAAGAAGCCTCACTCGAGTGAGGCTTCTTTCGCTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001012507.1-312s1c1
Sequence:CCGGGATTAGCAGAAGAGTCCAGGACTCGAGTCCTGGACTCTTCTGCTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001012507.1-245s1c1
Sequence:CCGGCCTCAACTTCGTCTGGAGAAACTCGAGTTTCTCCAGACGAAGTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122475    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012507.1-232s1c1
Sequence:CCGGCAAGCGAAAGAAGCCTCAACTCTCGAGAGTTGAGGCTTCTTTCGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001012507.1-345s1c1
Sequence:CCGGCGAGTAAATGTAGAGTCATTACTCGAGTAATGACTCTACATTTACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001012507.1-359s1c1
Sequence:CCGGGTCATTAACAAGGAGCATGTACTCGAGTACATGCTCCTTGTTAATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001012507.1-214s1c1
Sequence:CCGGCTTTCTAAAGCGAGTCTTCAACTCGAGTTGAAGACTCGCTTTAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144204    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012507.1-299s1c1
Sequence:CCGGCTGTTTGTTCATCGATTAGCACTCGAGTGCTAATCGATGAACAAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001012507
VALIDATED
CENPW MISSION shRNA Lentiviral Transduction Particles
centromere protein W
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001012507.1-270s1c1
Sequence:CCGGGTGACTTATTGGTCCATCTGACTCGAGTCAGATGGACCAATAAGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143488    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012507.1-213s1c1
Sequence:CCGGGCTTTCTAAAGCGAGTCTTCACTCGAGTGAAGACTCGCTTTAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001012507.1-181s1c1
Sequence:CCGGGAGGAAGCAGATAAAGCGGAACTCGAGTTCCGCTTTATCTGCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001012507.1-331s1c1
Sequence:CCGGGACAAACGCTTGTGCGAGTAACTCGAGTTACTCGCACAAGCGTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001012507.1-229s1c1
Sequence:CCGGCTTCAAGCGAAAGAAGCCTCACTCGAGTGAGGCTTCTTTCGCTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001012507.1-312s1c1
Sequence:CCGGGATTAGCAGAAGAGTCCAGGACTCGAGTCCTGGACTCTTCTGCTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001012507.1-245s1c1
Sequence:CCGGCCTCAACTTCGTCTGGAGAAACTCGAGTTTCTCCAGACGAAGTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122475    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012507.1-232s1c1
Sequence:CCGGCAAGCGAAAGAAGCCTCAACTCTCGAGAGTTGAGGCTTCTTTCGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001012507.1-345s1c1
Sequence:CCGGCGAGTAAATGTAGAGTCATTACTCGAGTAATGACTCTACATTTACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001012507.1-359s1c1
Sequence:CCGGGTCATTAACAAGGAGCATGTACTCGAGTACATGCTCCTTGTTAATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001012507.1-214s1c1
Sequence:CCGGCTTTCTAAAGCGAGTCTTCAACTCGAGTTGAAGACTCGCTTTAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144204    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012507.1-299s1c1
Sequence:CCGGCTGTTTGTTCATCGATTAGCACTCGAGTGCTAATCGATGAACAAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001109747
VALIDATED
CENPW MISSION shRNA Bacterial Glycerol Stock
centromere protein W
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000268954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001109747.1-232s21c1
Sequence:CCGGACAAATGCTTGTGAAAGTAAACTCGAGTTTACTTTCACAAGCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001109747.1-319s21c1
Sequence:CCGGTAGGTGTCAGCATGTGCTTAACTCGAGTTAAGCACATGCTGACACCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001109747.1-280s21c1
Sequence:CCGGCTGGCTGCAGGAAAGGTAATTCTCGAGAATTACCTTTCCTGCAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268903    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001109747.1-1047s21c1
Sequence:CCGGGTACTGATTATGCAATTATAGCTCGAGCTATAATTGCATAATCAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001109747.1-169s21c1
Sequence:CCGGTGCGACCTCCTGATCCATTTGCTCGAGCAAATGGATCAGGAGGTCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001109747
VALIDATED
CENPW MISSION shRNA shRNA Plasmid DNA
centromere protein W
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000268954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001109747.1-232s21c1
Sequence:CCGGACAAATGCTTGTGAAAGTAAACTCGAGTTTACTTTCACAAGCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001109747.1-319s21c1
Sequence:CCGGTAGGTGTCAGCATGTGCTTAACTCGAGTTAAGCACATGCTGACACCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001109747.1-280s21c1
Sequence:CCGGCTGGCTGCAGGAAAGGTAATTCTCGAGAATTACCTTTCCTGCAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268903    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001109747.1-1047s21c1
Sequence:CCGGGTACTGATTATGCAATTATAGCTCGAGCTATAATTGCATAATCAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001109747.1-169s21c1
Sequence:CCGGTGCGACCTCCTGATCCATTTGCTCGAGCAAATGGATCAGGAGGTCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001109747
VALIDATED
CENPW MISSION shRNA Lentiviral Transduction Particles
centromere protein W
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000268954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001109747.1-232s21c1
Sequence:CCGGACAAATGCTTGTGAAAGTAAACTCGAGTTTACTTTCACAAGCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001109747.1-319s21c1
Sequence:CCGGTAGGTGTCAGCATGTGCTTAACTCGAGTTAAGCACATGCTGACACCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001109747.1-280s21c1
Sequence:CCGGCTGGCTGCAGGAAAGGTAATTCTCGAGAATTACCTTTCCTGCAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268903    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001109747.1-1047s21c1
Sequence:CCGGGTACTGATTATGCAATTATAGCTCGAGCTATAATTGCATAATCAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001109747.1-169s21c1
Sequence:CCGGTGCGACCTCCTGATCCATTTGCTCGAGCAAATGGATCAGGAGGTCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks