EMAIL THIS PAGE TO A FRIEND

CEP104

centrosomal protein 104kDa

56 Gene Product Result for
Synonyms: GlyBP KIAA0562
Gene ID:
Mouse(230967) centrosomal protein 104
Rat(246295) centrosomal protein 104
Zebrafish(560451) centrosomal protein 104
chicken(419379) centrosomal protein 104kDa
dog(607774) centrosomal protein 104kDa
domestic cat(101088859) centrosomal protein 104kDa
Horse(100052540) centrosomal protein 104kDa
cow(785182) centrosomal protein 104kDa
sheep(101102160) centrosomal protein 104kDa
naked mole-rat(101714258) centrosomal protein 104kDa
domestic guinea pig(100727403) centrosomal protein 104kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014704 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014704 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014704 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177673 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177673 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177673 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014704 Rosetta Predictions human pricing
XM_001076921 Rosetta Predictions rat pricing
XM_575968 Rosetta Predictions rat pricing
NM_177673 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014704 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00238235 predicted 678
2 SASI_Hs01_00238236 predicted 718
3 SASI_Hs01_00238237 predicted 589
4 SASI_Hs01_00238238 predicted 1317
5 SASI_Hs01_00238240 predicted 928
6 SASI_Hs02_00346117 predicted 1608
7 SASI_Hs01_00238242 predicted 533
8 SASI_Hs01_00238243 predicted 1104
9 SASI_Hs01_00238244 predicted 2687
10 SASI_Hs02_00346118 predicted 1543
11 SASI_Hs01_00238239 predicted 1631
12 SASI_Hs01_00238241 predicted 1349
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076921 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00355039 predicted 2057
2 SASI_Rn02_00355040 predicted 689
3 SASI_Rn02_00355041 predicted 1893
4 SASI_Rn02_00355042 predicted 1886
5 SASI_Rn02_00355043 predicted 1942
6 SASI_Rn02_00355044 predicted 910
7 SASI_Rn02_00355045 predicted 1035
8 SASI_Rn02_00355046 predicted 598
9 SASI_Rn02_00355047 predicted 536
10 SASI_Rn02_00355048 predicted 1975
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575968 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00404587 predicted 2035
2 SASI_Rn02_00404588 predicted 2214
3 SASI_Rn02_00404589 predicted 2055
4 SASI_Rn02_00404590 predicted 2192
5 SASI_Rn02_00404591 predicted 2033
6 SASI_Rn02_00404592 predicted 2675
7 SASI_Rn02_00404593 predicted 2783
8 SASI_Rn02_00404594 predicted 2742
9 SASI_Rn02_00404595 predicted 2095
10 SASI_Rn02_00404596 predicted 2898
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177673 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00083245 predicted 1430
2 SASI_Mm01_00083246 predicted 362
3 SASI_Mm01_00083247 predicted 1543
4 SASI_Mm01_00083248 predicted 747
5 SASI_Mm01_00083249 predicted 664
6 SASI_Mm01_00083250 predicted 2585
7 SASI_Mm01_00083251 predicted 635
8 SASI_Mm01_00083252 predicted 316
9 SASI_Mm01_00083253 predicted 553
10 SASI_Mm01_00083254 predicted 201
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014704
VALIDATED
CEP104 MISSION shRNA Bacterial Glycerol Stock
centrosomal protein 104kDa
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000240497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014704.2-1809s21c1
Sequence:CCGGCTCGTTAGAAGAGCCATAAAGCTCGAGCTTTATGGCTCTTCTAACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240498    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014704.2-3291s21c1
Sequence:CCGGAGCTCTCGTGCAAACGATATGCTCGAGCATATCGTTTGCACGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014704.2-540s21c1
Sequence:CCGGTTACTTGCTCACCAGTATATGCTCGAGCATATACTGGTGAGCAAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014704.2-508s21c1
Sequence:CCGGTGGTGGAGAGATGTCGAATAACTCGAGTTATTCGACATCTCTCCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149999    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014704.1-1361s1c1
Sequence:CCGGCTAACTATTTCTCCTCAGCATCTCGAGATGCTGAGGAGAAATAGTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147848    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014704.1-920s1c1
Sequence:CCGGGATATGTACCAAGATCCAGAACTCGAGTTCTGGATCTTGGTACATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146692    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014704.1-1466s1c1
Sequence:CCGGCCAGCTATTCGTAAGCATTATCTCGAGATAATGCTTACGAATAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014704
VALIDATED
CEP104 MISSION shRNA shRNA Plasmid DNA
centrosomal protein 104kDa
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000240497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014704.2-1809s21c1
Sequence:CCGGCTCGTTAGAAGAGCCATAAAGCTCGAGCTTTATGGCTCTTCTAACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240498    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014704.2-3291s21c1
Sequence:CCGGAGCTCTCGTGCAAACGATATGCTCGAGCATATCGTTTGCACGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014704.2-540s21c1
Sequence:CCGGTTACTTGCTCACCAGTATATGCTCGAGCATATACTGGTGAGCAAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014704.2-508s21c1
Sequence:CCGGTGGTGGAGAGATGTCGAATAACTCGAGTTATTCGACATCTCTCCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149999    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014704.1-1361s1c1
Sequence:CCGGCTAACTATTTCTCCTCAGCATCTCGAGATGCTGAGGAGAAATAGTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147848    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014704.1-920s1c1
Sequence:CCGGGATATGTACCAAGATCCAGAACTCGAGTTCTGGATCTTGGTACATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146692    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014704.1-1466s1c1
Sequence:CCGGCCAGCTATTCGTAAGCATTATCTCGAGATAATGCTTACGAATAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014704
VALIDATED
CEP104 MISSION shRNA Lentiviral Transduction Particles
centrosomal protein 104kDa
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000240497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014704.2-1809s21c1
Sequence:CCGGCTCGTTAGAAGAGCCATAAAGCTCGAGCTTTATGGCTCTTCTAACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240498    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014704.2-3291s21c1
Sequence:CCGGAGCTCTCGTGCAAACGATATGCTCGAGCATATCGTTTGCACGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014704.2-540s21c1
Sequence:CCGGTTACTTGCTCACCAGTATATGCTCGAGCATATACTGGTGAGCAAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014704.2-508s21c1
Sequence:CCGGTGGTGGAGAGATGTCGAATAACTCGAGTTATTCGACATCTCTCCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149999    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014704.1-1361s1c1
Sequence:CCGGCTAACTATTTCTCCTCAGCATCTCGAGATGCTGAGGAGAAATAGTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147848    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014704.1-920s1c1
Sequence:CCGGGATATGTACCAAGATCCAGAACTCGAGTTCTGGATCTTGGTACATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146692    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014704.1-1466s1c1
Sequence:CCGGCCAGCTATTCGTAAGCATTATCTCGAGATAATGCTTACGAATAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177673
CEP104 MISSION shRNA Bacterial Glycerol Stock
centrosomal protein 104kDa
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000194490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177673.2-2698s1c1
Sequence:CCGGGCGCAAGACACATGTTCTCTACTCGAGTAGAGAACATGTGTCTTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175806    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177673.2-3001s1c1
Sequence:CCGGGTTATGACCAAAGAGCCCTTTCTCGAGAAAGGGCTCTTTGGTCATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177673.2-1568s1c1
Sequence:CCGGGCTTCATTGAAATTGCTGAAACTCGAGTTTCAGCAATTTCAATGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177673.2-473s1c1
Sequence:CCGGCATGCCAACAAATACAACATACTCGAGTATGTTGTATTTGTTGGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177673
CEP104 MISSION shRNA shRNA Plasmid DNA
centrosomal protein 104kDa
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000194490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177673.2-2698s1c1
Sequence:CCGGGCGCAAGACACATGTTCTCTACTCGAGTAGAGAACATGTGTCTTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175806    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177673.2-3001s1c1
Sequence:CCGGGTTATGACCAAAGAGCCCTTTCTCGAGAAAGGGCTCTTTGGTCATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177673.2-1568s1c1
Sequence:CCGGGCTTCATTGAAATTGCTGAAACTCGAGTTTCAGCAATTTCAATGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177673.2-473s1c1
Sequence:CCGGCATGCCAACAAATACAACATACTCGAGTATGTTGTATTTGTTGGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177673
CEP104 MISSION shRNA Lentiviral Transduction Particles
centrosomal protein 104kDa
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000194490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177673.2-2698s1c1
Sequence:CCGGGCGCAAGACACATGTTCTCTACTCGAGTAGAGAACATGTGTCTTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175806    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177673.2-3001s1c1
Sequence:CCGGGTTATGACCAAAGAGCCCTTTCTCGAGAAAGGGCTCTTTGGTCATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177673.2-1568s1c1
Sequence:CCGGGCTTCATTGAAATTGCTGAAACTCGAGTTTCAGCAATTTCAATGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177673.2-473s1c1
Sequence:CCGGCATGCCAACAAATACAACATACTCGAGTATGTTGTATTTGTTGGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks