EMAIL THIS PAGE TO A FRIEND

CEP112

centrosomal protein 112kDa

127 Gene Product Result for
Synonyms: CCDC46 MACOCO
UniProtKB ID: Q8N8E3, Q6PIB5, Q8NCR4, Q8NFR4
Gene ID:
Human(201134) Summary: This gene encodes a protein with filament, myosin tail and ATPase domains. Orthologs of this gene exist in mouse, rat and chimp. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Mouse(76380) centrosomal protein 112
Rat(287776) centrosomal protein 112kDa
sheep(101117261) centrosomal protein 112kDa
Domestic Rabbit(100339514) centrosomal protein 112kDa
naked mole-rat(101700917) centrosomal protein 112kDa
domestic guinea pig(100716703) centrosomal protein 112kDa
chicken(101749632) centrosomal protein 112kDa
Horse(100053434) centrosomal protein 112kDa
cow(617266) centrosomal protein 112kDa
domestic cat(101092808) centrosomal protein 112kDa
dog(480462) centrosomal protein 112kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029586 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029586 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029586 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_145036 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145036 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145036 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001037325 Rosetta Predictions human pricing
NM_145036 Rosetta Predictions human pricing
NM_001105849 Rosetta Predictions rat pricing
NM_029586 Rosetta Predictions mouse pricing
NM_029606 Rosetta Predictions mouse pricing
NM_145688 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037325 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00223733 predicted 783
2 SASI_Hs01_00223735 predicted 851
3 SASI_Hs01_00223736 predicted 799
4 SASI_Hs01_00223737 predicted 824
5 SASI_Hs01_00223739 predicted 790
6 SASI_Hs01_00223740 predicted 630
7 SASI_Hs01_00223742 predicted 861
8 SASI_Hs02_00308261 predicted 822
9 SASI_Hs02_00308262 predicted 884
10 SASI_Hs02_00308263 predicted 790
11 SASI_Hs01_00223734 predicted 836
12 SASI_Hs01_00223738 predicted 928
13 SASI_Hs01_00223741 predicted 646
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145036 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226450 predicted 3030
2 SASI_Hs01_00226452 predicted 3110
3 SASI_Hs01_00226453 predicted 3047
4 SASI_Hs01_00226454 predicted 3078
5 SASI_Hs01_00226456 predicted 3043
6 SASI_Hs01_00226457 predicted 2882
7 SASI_Hs01_00226459 predicted 3116
8 SASI_Hs02_00364905 predicted 3073
9 SASI_Hs02_00364906 predicted 3141
10 SASI_Hs02_00364907 predicted 3043
11 SASI_Hs01_00226451 predicted 3089
12 SASI_Hs01_00226455 predicted 3181
13 SASI_Hs01_00226458 predicted 2895
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105849 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213132 predicted 1310
2 SASI_Rn02_00213133 predicted 478
3 SASI_Rn02_00213134 predicted 2289
4 SASI_Rn02_00213135 predicted 2403
5 SASI_Rn02_00213136 predicted 1518
6 SASI_Rn02_00213137 predicted 768
7 SASI_Rn02_00213138 predicted 1154
8 SASI_Rn02_00213139 predicted 1548
9 SASI_Rn02_00213140 predicted 871
10 SASI_Rn02_00213141 predicted 2765
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029586 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00335549 predicted 630
2 SASI_Mm02_00335550 predicted 565
3 SASI_Mm02_00335551 predicted 576
4 SASI_Mm02_00335552 predicted 605
5 SASI_Mm02_00335553 predicted 515
6 SASI_Mm02_00335554 predicted 578
7 SASI_Mm02_00335555 predicted 488
8 SASI_Mm02_00335556 predicted 591
9 SASI_Mm02_00335557 predicted 518
10 SASI_Mm02_00335558 predicted 526
11 SASI_Mm01_00043280 predicted 451
12 SASI_Mm01_00043281 predicted 362
13 SASI_Mm01_00043282 predicted 344
14 SASI_Mm01_00043283 predicted 407
15 SASI_Mm01_00043284 predicted 429
16 SASI_Mm01_00043285 predicted 366
17 SASI_Mm01_00043286 predicted 400
18 SASI_Mm01_00043287 predicted 335
19 SASI_Mm01_00043288 predicted 362
20 SASI_Mm01_00043289 predicted 333
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029606 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00335578 predicted 3179
2 SASI_Mm02_00335579 predicted 3115
3 SASI_Mm02_00335580 predicted 3123
4 SASI_Mm02_00335581 predicted 3151
5 SASI_Mm02_00335582 predicted 3062
6 SASI_Mm02_00335583 predicted 3122
7 SASI_Mm02_00335584 predicted 3036
8 SASI_Mm02_00335585 predicted 3144
9 SASI_Mm02_00335586 predicted 3066
10 SASI_Mm02_00335587 predicted 3076
11 SASI_Mm01_00141629 predicted 547
12 SASI_Mm01_00141630 predicted 920
13 SASI_Mm01_00141631 predicted 2289
14 SASI_Mm01_00141632 predicted 800
15 SASI_Mm01_00141633 predicted 418
16 SASI_Mm01_00141634 predicted 705
17 SASI_Mm01_00141635 predicted 490
18 SASI_Mm01_00141636 predicted 1648
19 SASI_Mm01_00141637 predicted 2377
20 SASI_Mm01_00141638 predicted 1407
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145688 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00341231 predicted 856
2 SASI_Mm02_00341232 predicted 792
3 SASI_Mm02_00341233 predicted 803
4 SASI_Mm02_00341234 predicted 826
5 SASI_Mm02_00341235 predicted 732
6 SASI_Mm02_00341236 predicted 795
7 SASI_Mm02_00341237 predicted 710
8 SASI_Mm02_00341238 predicted 812
9 SASI_Mm02_00341239 predicted 742
10 SASI_Mm02_00341240 predicted 749
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029586
VALIDATED
CEP112 MISSION shRNA Bacterial Glycerol Stock
centrosomal protein 112kDa
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000292778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029586.2-271s21c1
Sequence:CCGGGAACTAGAAACCCGCTCTCATCTCGAGATGAGAGCGGGTTTCTAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029586.2-487s21c1
Sequence:CCGGGAAGAACTGACCACCTACCAACTCGAGTTGGTAGGTGGTCAGTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029586.2-339s21c1
Sequence:CCGGGCAGGAGCAGATAATGTACATCTCGAGATGTACATTATCTGCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029586.2-400s21c1
Sequence:CCGGGCGTCTCTAAGACAAGAACTTCTCGAGAAGTTCTTGTCTTAGAGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029586.1-401s1c1
Sequence:CCGGGCGTCTCTAAGACAAGAACTTCTCGAGAAGTTCTTGTCTTAGAGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029586.1-340s1c1
Sequence:CCGGGCAGGAGCAGATAATGTACATCTCGAGATGTACATTATCTGCTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029586.1-272s1c1
Sequence:CCGGGAACTAGAAACCCGCTCTCATCTCGAGATGAGAGCGGGTTTCTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029586.1-488s1c1
Sequence:CCGGGAAGAACTGACCACCTACCAACTCGAGTTGGTAGGTGGTCAGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029586
VALIDATED
CEP112 MISSION shRNA shRNA Plasmid DNA
centrosomal protein 112kDa
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000292778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029586.2-271s21c1
Sequence:CCGGGAACTAGAAACCCGCTCTCATCTCGAGATGAGAGCGGGTTTCTAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029586.2-487s21c1
Sequence:CCGGGAAGAACTGACCACCTACCAACTCGAGTTGGTAGGTGGTCAGTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029586.2-339s21c1
Sequence:CCGGGCAGGAGCAGATAATGTACATCTCGAGATGTACATTATCTGCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029586.2-400s21c1
Sequence:CCGGGCGTCTCTAAGACAAGAACTTCTCGAGAAGTTCTTGTCTTAGAGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029586.1-401s1c1
Sequence:CCGGGCGTCTCTAAGACAAGAACTTCTCGAGAAGTTCTTGTCTTAGAGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029586.1-340s1c1
Sequence:CCGGGCAGGAGCAGATAATGTACATCTCGAGATGTACATTATCTGCTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029586.1-272s1c1
Sequence:CCGGGAACTAGAAACCCGCTCTCATCTCGAGATGAGAGCGGGTTTCTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029586.1-488s1c1
Sequence:CCGGGAAGAACTGACCACCTACCAACTCGAGTTGGTAGGTGGTCAGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029586
VALIDATED
CEP112 MISSION shRNA Lentiviral Transduction Particles
centrosomal protein 112kDa
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000292778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029586.2-271s21c1
Sequence:CCGGGAACTAGAAACCCGCTCTCATCTCGAGATGAGAGCGGGTTTCTAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029586.2-487s21c1
Sequence:CCGGGAAGAACTGACCACCTACCAACTCGAGTTGGTAGGTGGTCAGTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029586.2-339s21c1
Sequence:CCGGGCAGGAGCAGATAATGTACATCTCGAGATGTACATTATCTGCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029586.2-400s21c1
Sequence:CCGGGCGTCTCTAAGACAAGAACTTCTCGAGAAGTTCTTGTCTTAGAGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029586.1-401s1c1
Sequence:CCGGGCGTCTCTAAGACAAGAACTTCTCGAGAAGTTCTTGTCTTAGAGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029586.1-340s1c1
Sequence:CCGGGCAGGAGCAGATAATGTACATCTCGAGATGTACATTATCTGCTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029586.1-272s1c1
Sequence:CCGGGAACTAGAAACCCGCTCTCATCTCGAGATGAGAGCGGGTTTCTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029586.1-488s1c1
Sequence:CCGGGAAGAACTGACCACCTACCAACTCGAGTTGGTAGGTGGTCAGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145036
VALIDATED
CEP112 MISSION shRNA Bacterial Glycerol Stock
centrosomal protein 112kDa
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244135    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_145036.3-3097s21c1
Sequence:CCGGAGAATGCAACGGATGCAATTTCTCGAGAAATTGCATCCGTTGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_145036.3-270s21c1
Sequence:CCGGTGATCACTTTGTGGTTGATATCTCGAGATATCAACCACAAAGTGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_145036.3-2280s21c1
Sequence:CCGGCCGAGACCATGAACGGGAAATCTCGAGATTTCCCGTTCATGGTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_145036.3-1186s21c1
Sequence:CCGGATACGTGACTGTCAAGTTATCCTCGAGGATAACTTGACAGTCACGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_145036.3-826s21c1
Sequence:CCGGGACATTGAAGCTCGCCTTAATCTCGAGATTAAGGCGAGCTTCAATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183760    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145036.1-1745s1c1
Sequence:CCGGCAGATAACTTACATACGACAACTCGAGTTGTCGTATGTAAGTTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179475    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145036.1-1514s1c1
Sequence:CCGGGCAGAACTTCAGACAACCATTCTCGAGAATGGTTGTCTGAAGTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183634    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145036.1-1238s1c1
Sequence:CCGGGTTCACAAGTTGAGAGAAGAACTCGAGTTCTTCTCTCAACTTGTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145036
VALIDATED
CEP112 MISSION shRNA shRNA Plasmid DNA
centrosomal protein 112kDa
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244135    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_145036.3-3097s21c1
Sequence:CCGGAGAATGCAACGGATGCAATTTCTCGAGAAATTGCATCCGTTGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_145036.3-270s21c1
Sequence:CCGGTGATCACTTTGTGGTTGATATCTCGAGATATCAACCACAAAGTGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_145036.3-2280s21c1
Sequence:CCGGCCGAGACCATGAACGGGAAATCTCGAGATTTCCCGTTCATGGTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_145036.3-1186s21c1
Sequence:CCGGATACGTGACTGTCAAGTTATCCTCGAGGATAACTTGACAGTCACGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_145036.3-826s21c1
Sequence:CCGGGACATTGAAGCTCGCCTTAATCTCGAGATTAAGGCGAGCTTCAATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183760    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145036.1-1745s1c1
Sequence:CCGGCAGATAACTTACATACGACAACTCGAGTTGTCGTATGTAAGTTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179475    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145036.1-1514s1c1
Sequence:CCGGGCAGAACTTCAGACAACCATTCTCGAGAATGGTTGTCTGAAGTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183634    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145036.1-1238s1c1
Sequence:CCGGGTTCACAAGTTGAGAGAAGAACTCGAGTTCTTCTCTCAACTTGTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145036
VALIDATED
CEP112 MISSION shRNA Lentiviral Transduction Particles
centrosomal protein 112kDa
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244135    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_145036.3-3097s21c1
Sequence:CCGGAGAATGCAACGGATGCAATTTCTCGAGAAATTGCATCCGTTGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_145036.3-270s21c1
Sequence:CCGGTGATCACTTTGTGGTTGATATCTCGAGATATCAACCACAAAGTGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_145036.3-2280s21c1
Sequence:CCGGCCGAGACCATGAACGGGAAATCTCGAGATTTCCCGTTCATGGTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_145036.3-1186s21c1
Sequence:CCGGATACGTGACTGTCAAGTTATCCTCGAGGATAACTTGACAGTCACGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_145036.3-826s21c1
Sequence:CCGGGACATTGAAGCTCGCCTTAATCTCGAGATTAAGGCGAGCTTCAATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183760    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145036.1-1745s1c1
Sequence:CCGGCAGATAACTTACATACGACAACTCGAGTTGTCGTATGTAAGTTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179475    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145036.1-1514s1c1
Sequence:CCGGGCAGAACTTCAGACAACCATTCTCGAGAATGGTTGTCTGAAGTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183634    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145036.1-1238s1c1
Sequence:CCGGGTTCACAAGTTGAGAGAAGAACTCGAGTTCTTCTCTCAACTTGTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks