EMAIL THIS PAGE TO A FRIEND

CEP120

centrosomal protein 120kDa

123 Gene Product Result for
Synonyms: CCDC100
UniProtKB ID: Q8N960, Q6AI52, Q6AW89, Q8IWB5, Q8N9Y0, Q8NDE8
Gene ID:
Human(153241) Summary: This gene encodes a protein that functions in the microtubule-dependent coupling of the nucleus and the centrosome. A similar protein in mouse plays a role in both interkinetic nuclear migration, which is a characteristic pattern of nuclear movement in neural progenitors, and in neural progenitor self-renewal. Mutations in this gene are predicted to result in neurogenic defects. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
Mouse(225523) centrosomal protein 120
Rat(307302) centrosomal protein 120
Zebrafish(100334628) centrosomal protein 120kDa
cow(534400) centrosomal protein 120kDa
Horse(100063918) centrosomal protein 120kDa
domestic cat(101084767) centrosomal protein 120kDa
chicken(426802) centrosomal protein 120kDa
dog(474659) centrosomal protein 120kDa
domestic guinea pig(100718525) centrosomal protein 120kDa
naked mole-rat(101719274) centrosomal protein 120kDa
sheep(101110325) centrosomal protein 120kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178686 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178686 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178686 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_153223 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153223 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153223 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153223 Rosetta Predictions human pricing
XM_001055603 Rosetta Predictions rat pricing
XM_225760 Rosetta Predictions rat pricing
NM_178686 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153223 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00207584 predicted 2670
2 SASI_Hs01_00207585 predicted 1542
3 SASI_Hs01_00207586 predicted 1636
4 SASI_Hs01_00207587 predicted 843
5 SASI_Hs01_00207588 predicted 293
6 SASI_Hs01_00207589 predicted 1879
7 SASI_Hs01_00207590 predicted 370
8 SASI_Hs01_00207592 predicted 1365
9 SASI_Hs01_00207593 predicted 2663
10 SASI_Hs02_00367083 predicted 1102
11 SASI_Hs01_00207591 predicted 773
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055603 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00280261 predicted 1759
2 SASI_Rn02_00280262 predicted 2736
3 SASI_Rn02_00280263 predicted 245
4 SASI_Rn02_00280264 predicted 911
5 SASI_Rn02_00280265 predicted 2971
6 SASI_Rn02_00280266 predicted 984
7 SASI_Rn02_00280267 predicted 1790
8 SASI_Rn02_00280268 predicted 1714
9 SASI_Rn02_00280269 predicted 2846
10 SASI_Rn02_00280270 predicted 1696
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_225760 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00383124 predicted 1762
2 SASI_Rn02_00383125 predicted 2730
3 SASI_Rn02_00383126 predicted 251
4 SASI_Rn02_00383127 predicted 912
5 SASI_Rn02_00383128 predicted 2969
6 SASI_Rn02_00383129 predicted 986
7 SASI_Rn02_00383130 predicted 1787
8 SASI_Rn02_00383131 predicted 1712
9 SASI_Rn02_00383132 predicted 2837
10 SASI_Rn02_00383133 predicted 1691
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178686 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00077935 predicted 2674
2 SASI_Mm01_00077936 predicted 2440
3 SASI_Mm01_00077937 predicted 1908
4 SASI_Mm01_00077938 predicted 3061
5 SASI_Mm01_00077939 predicted 2114
6 SASI_Mm01_00077940 predicted 2449
7 SASI_Mm01_00077941 predicted 1849
8 SASI_Mm01_00077942 predicted 1675
9 SASI_Mm01_00077943 predicted 1547
10 SASI_Mm01_00077944 predicted 1732
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178686
CEP120 MISSION shRNA Bacterial Glycerol Stock
centrosomal protein 120kDa
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183949    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178686.2-314s1c1
Sequence:CCGGCCGATCAAACTCCAGTGCTTTCTCGAGAAAGCACTGGAGTTTGATCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178686.2-778s1c1
Sequence:CCGGCGATGTTACAAACGAGCCTTTCTCGAGAAAGGCTCGTTTGTAACATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178686.2-585s1c1
Sequence:CCGGCGAAGGACATTGTTGCAGTATCTCGAGATACTGCAACAATGTCCTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178686.2-242s1c1
Sequence:CCGGCCAGAATTTGCTACTGAGCTACTCGAGTAGCTCAGTAGCAAATTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178686.2-970s1c1
Sequence:CCGGGAAGGGCAGTACAGAGATTAACTCGAGTTAATCTCTGTACTGCCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216045    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178686.3-3587s1c1
Sequence:CCGGCAAATTAGTCATTGCTTAAACCTCGAGGTTTAAGCAATGACTAATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217178    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178686.3-1103s1c1
Sequence:CCGGCATCGATTCCCAGTCTTTAATCTCGAGATTAAAGACTGGGAATCGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178686
CEP120 MISSION shRNA shRNA Plasmid DNA
centrosomal protein 120kDa
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183949    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178686.2-314s1c1
Sequence:CCGGCCGATCAAACTCCAGTGCTTTCTCGAGAAAGCACTGGAGTTTGATCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178686.2-778s1c1
Sequence:CCGGCGATGTTACAAACGAGCCTTTCTCGAGAAAGGCTCGTTTGTAACATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178686.2-585s1c1
Sequence:CCGGCGAAGGACATTGTTGCAGTATCTCGAGATACTGCAACAATGTCCTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178686.2-242s1c1
Sequence:CCGGCCAGAATTTGCTACTGAGCTACTCGAGTAGCTCAGTAGCAAATTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178686.2-970s1c1
Sequence:CCGGGAAGGGCAGTACAGAGATTAACTCGAGTTAATCTCTGTACTGCCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216045    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178686.3-3587s1c1
Sequence:CCGGCAAATTAGTCATTGCTTAAACCTCGAGGTTTAAGCAATGACTAATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217178    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178686.3-1103s1c1
Sequence:CCGGCATCGATTCCCAGTCTTTAATCTCGAGATTAAAGACTGGGAATCGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178686
CEP120 MISSION shRNA Lentiviral Transduction Particles
centrosomal protein 120kDa
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183949    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178686.2-314s1c1
Sequence:CCGGCCGATCAAACTCCAGTGCTTTCTCGAGAAAGCACTGGAGTTTGATCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178686.2-778s1c1
Sequence:CCGGCGATGTTACAAACGAGCCTTTCTCGAGAAAGGCTCGTTTGTAACATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178686.2-585s1c1
Sequence:CCGGCGAAGGACATTGTTGCAGTATCTCGAGATACTGCAACAATGTCCTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178686.2-242s1c1
Sequence:CCGGCCAGAATTTGCTACTGAGCTACTCGAGTAGCTCAGTAGCAAATTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178686.2-970s1c1
Sequence:CCGGGAAGGGCAGTACAGAGATTAACTCGAGTTAATCTCTGTACTGCCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216045    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178686.3-3587s1c1
Sequence:CCGGCAAATTAGTCATTGCTTAAACCTCGAGGTTTAAGCAATGACTAATTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217178    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178686.3-1103s1c1
Sequence:CCGGCATCGATTCCCAGTCTTTAATCTCGAGATTAAAGACTGGGAATCGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153223
CEP120 MISSION shRNA Bacterial Glycerol Stock
centrosomal protein 120kDa
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000129963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153223.1-1490s1c1
Sequence:CCGGGCGACAAGAATTGTTGGATATCTCGAGATATCCAACAATTCTTGTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129872    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153223.1-2076s1c1
Sequence:CCGGGCGGTAATTTCCAGTTCTATACTCGAGTATAGAACTGGAAATTACCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153223.1-366s1c1
Sequence:CCGGCAAGACACCTTCTTAAGGATTCTCGAGAATCCTTAAGAAGGTGTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128581    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153223.1-2182s1c1
Sequence:CCGGGAGACCAATTGTAACCAGTTTCTCGAGAAACTGGTTACAATTGGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153223.1-1392s1c1
Sequence:CCGGGAAAGTCAAATGGCTCGTCTTCTCGAGAAGACGAGCCATTTGACTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153223.1-1629s1c1
Sequence:CCGGGATTATTTGACTCGCCTGATACTCGAGTATCAGGCGAGTCAAATAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349605    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153223.2-3356s21c1
Sequence:CCGGGCGGTAATTTCCAGTTCTATACTCGAGTATAGAACTGGAAATTACCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153223.2-2770s21c1
Sequence:CCGGGCGACAAGAATTGTTGGATATCTCGAGATATCCAACAATTCTTGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153223.2-1646s21c1
Sequence:CCGGCAAGACACCTTCTTAAGGATTCTCGAGAATCCTTAAGAAGGTGTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153223.2-2909s21c1
Sequence:CCGGGATTATTTGACTCGCCTGATACTCGAGTATCAGGCGAGTCAAATAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153223
CEP120 MISSION shRNA shRNA Plasmid DNA
centrosomal protein 120kDa
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000129963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153223.1-1490s1c1
Sequence:CCGGGCGACAAGAATTGTTGGATATCTCGAGATATCCAACAATTCTTGTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129872    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153223.1-2076s1c1
Sequence:CCGGGCGGTAATTTCCAGTTCTATACTCGAGTATAGAACTGGAAATTACCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153223.1-366s1c1
Sequence:CCGGCAAGACACCTTCTTAAGGATTCTCGAGAATCCTTAAGAAGGTGTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128581    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153223.1-2182s1c1
Sequence:CCGGGAGACCAATTGTAACCAGTTTCTCGAGAAACTGGTTACAATTGGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153223.1-1392s1c1
Sequence:CCGGGAAAGTCAAATGGCTCGTCTTCTCGAGAAGACGAGCCATTTGACTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153223.1-1629s1c1
Sequence:CCGGGATTATTTGACTCGCCTGATACTCGAGTATCAGGCGAGTCAAATAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349605    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153223.2-3356s21c1
Sequence:CCGGGCGGTAATTTCCAGTTCTATACTCGAGTATAGAACTGGAAATTACCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153223.2-2770s21c1
Sequence:CCGGGCGACAAGAATTGTTGGATATCTCGAGATATCCAACAATTCTTGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153223.2-1646s21c1
Sequence:CCGGCAAGACACCTTCTTAAGGATTCTCGAGAATCCTTAAGAAGGTGTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153223.2-2909s21c1
Sequence:CCGGGATTATTTGACTCGCCTGATACTCGAGTATCAGGCGAGTCAAATAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153223
CEP120 MISSION shRNA Lentiviral Transduction Particles
centrosomal protein 120kDa
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000129963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153223.1-1490s1c1
Sequence:CCGGGCGACAAGAATTGTTGGATATCTCGAGATATCCAACAATTCTTGTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129872    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153223.1-2076s1c1
Sequence:CCGGGCGGTAATTTCCAGTTCTATACTCGAGTATAGAACTGGAAATTACCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153223.1-366s1c1
Sequence:CCGGCAAGACACCTTCTTAAGGATTCTCGAGAATCCTTAAGAAGGTGTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128581    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153223.1-2182s1c1
Sequence:CCGGGAGACCAATTGTAACCAGTTTCTCGAGAAACTGGTTACAATTGGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153223.1-1392s1c1
Sequence:CCGGGAAAGTCAAATGGCTCGTCTTCTCGAGAAGACGAGCCATTTGACTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153223.1-1629s1c1
Sequence:CCGGGATTATTTGACTCGCCTGATACTCGAGTATCAGGCGAGTCAAATAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349605    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153223.2-3356s21c1
Sequence:CCGGGCGGTAATTTCCAGTTCTATACTCGAGTATAGAACTGGAAATTACCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153223.2-2770s21c1
Sequence:CCGGGCGACAAGAATTGTTGGATATCTCGAGATATCCAACAATTCTTGTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153223.2-1646s21c1
Sequence:CCGGCAAGACACCTTCTTAAGGATTCTCGAGAATCCTTAAGAAGGTGTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153223.2-2909s21c1
Sequence:CCGGGATTATTTGACTCGCCTGATACTCGAGTATCAGGCGAGTCAAATAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)