EMAIL THIS PAGE TO A FRIEND

CEP128

centrosomal protein 128kDa

139 Gene Product Result for
Synonyms: C14orf145 C14orf61 LEDP/132
UniProtKB ID: Q6ZU80, B9EK52, Q86X97, Q96ML4
Gene ID:
Mouse(75216) centrosomal protein 128
sheep(101116835) centrosomal protein 128kDa
naked mole-rat(101696919) centrosomal protein 128kDa
domestic guinea pig(100729658) centrosomal protein 128kDa
Zebrafish(100037385) centrosomal protein 128
chicken(428899) centrosomal protein 128kDa
dog(490814) centrosomal protein 128kDa
Horse(100059813) centrosomal protein 128kDa
cow(529746) centrosomal protein 128kDa
domestic cat(101089700) centrosomal protein 128kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152446 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152446 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152446 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_181815 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181815 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181815 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU073221 MISSION® esiRNA esiRNA human C14orf145 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152446 Rosetta Predictions human pricing
NM_181815 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152446 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00021794 predicted 2633
2 SASI_Hs02_00366210 predicted 2614
3 SASI_Hs01_00021796 predicted 2203
4 SASI_Hs01_00021797 predicted 3166
5 SASI_Hs02_00366211 predicted 2320
6 SASI_Hs01_00021798 predicted 1621
7 SASI_Hs01_00021799 predicted 3089
8 SASI_Hs01_00021800 predicted 2594
9 SASI_Hs01_00021802 predicted 3525
10 SASI_Hs01_00021803 predicted 1933
11 SASI_Hs01_00021795 predicted 1450
12 SASI_Hs01_00021801 predicted 1872
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181815 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00081985 predicted 1971
2 SASI_Mm01_00081986 predicted 551
3 SASI_Mm01_00081987 predicted 973
4 SASI_Mm01_00081988 predicted 706
5 SASI_Mm01_00081989 predicted 1064
6 SASI_Mm01_00081992 predicted 558
7 SASI_Mm02_00349924 predicted 3515
8 SASI_Mm02_00349925 predicted 3712
9 SASI_Mm02_00349926 predicted 718
10 SASI_Mm01_00081994 predicted 1442
11 SASI_Mm01_00081990 predicted 2127
12 SASI_Mm01_00081991 predicted 2479
13 SASI_Mm01_00081993 predicted 3520
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152446
VALIDATED
CEP128 MISSION shRNA Bacterial Glycerol Stock
centrosomal protein 128kDa
Human
18 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000451162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152446.3-1807s21c1
Sequence:CCGGTTGAATGATGTCCTAACAAAGCTCGAGCTTTGTTAGGACATCATTCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152446.3-1860s21c1
Sequence:CCGGGGAGGAGAAATTACGTGATATCTCGAGATATCACGTAATTTCTCCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000448127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152446.3-1936s21c1
Sequence:CCGGCATAGACTGGAGAGCGAATTGCTCGAGCAATTCGCTCTCCAGTCTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_152446.2-354s1c1
Sequence:CCGGGCTTGGACGATACCGAGAATACTCGAGTATTCTCGGTATCGTCCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152446.2-2316s1c1
Sequence:CCGGCCAGGAGCTTATGAAGCACTTCTCGAGAAGTGCTTCATAAGCTCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152446.2-2627s1c1
Sequence:CCGGGCTTGGAGACTGAACAGGAATCTCGAGATTCCTGTTCAGTCTCCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142061    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152446.2-3317s1c1
Sequence:CCGGGCTTCCTGTCTAGTCCAAGATCTCGAGATCTTGGACTAGACAGGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_152446.2-3184s1c1
Sequence:CCGGCGCAGAAATTCTCTTCAGCATCTCGAGATGCTGAAGAGAATTTCTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122316    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152446.2-1138s1c1
Sequence:CCGGCGAAAGGGTTTACAGCATCAACTCGAGTTGATGCTGTAAACCCTTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121946    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152446.2-3532s1c1
Sequence:CCGGCCAGATTATCTAACAGACATACTCGAGTATGTCTGTTAGATAATCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145613    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152446.2-3612s1c1
Sequence:CCGGCCTTGTGAATGGTAAACCAATCTCGAGATTGGTTTACCATTCACAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152446.2-2113s1c1
Sequence:CCGGGCTAATAAATTGGCTGAGGAACTCGAGTTCCTCAGCCAATTTATTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_152446.2-1679s1c1
Sequence:CCGGCGTTGGAGAAACAATCTGAAACTCGAGTTTCAGATTGTTTCTCCAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144260    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152446.2-3849s1c1
Sequence:CCGGCTTTAGATTCAGGGAGCATTTCTCGAGAAATGCTCCCTGAATCTAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152446.2-2773s1c1
Sequence:CCGGGCAGAAAGCAAGACTAAACTTCTCGAGAAGTTTAGTCTTGCTTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145095    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152446.2-3676s1c1
Sequence:CCGGGCAACTTATACTAGCACAGAACTCGAGTTCTGTGCTAGTATAAGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152446.2-766s1c1
Sequence:CCGGGCTTTGGAAGAATTGACTGAACTCGAGTTCAGTCAATTCTTCCAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152446.2-1038s1c1
Sequence:CCGGGCTATCTCGAAGGTTATTGAACTCGAGTTCAATAACCTTCGAGATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152446
VALIDATED
CEP128 MISSION shRNA shRNA Plasmid DNA
centrosomal protein 128kDa
Human
18 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000451162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152446.3-1807s21c1
Sequence:CCGGTTGAATGATGTCCTAACAAAGCTCGAGCTTTGTTAGGACATCATTCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000439480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152446.3-1860s21c1
Sequence:CCGGGGAGGAGAAATTACGTGATATCTCGAGATATCACGTAATTTCTCCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000448127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152446.3-1936s21c1
Sequence:CCGGCATAGACTGGAGAGCGAATTGCTCGAGCAATTCGCTCTCCAGTCTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_152446.2-354s1c1
Sequence:CCGGGCTTGGACGATACCGAGAATACTCGAGTATTCTCGGTATCGTCCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152446.2-2316s1c1
Sequence:CCGGCCAGGAGCTTATGAAGCACTTCTCGAGAAGTGCTTCATAAGCTCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152446.2-2627s1c1
Sequence:CCGGGCTTGGAGACTGAACAGGAATCTCGAGATTCCTGTTCAGTCTCCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142061    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152446.2-3317s1c1
Sequence:CCGGGCTTCCTGTCTAGTCCAAGATCTCGAGATCTTGGACTAGACAGGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_152446.2-3184s1c1
Sequence:CCGGCGCAGAAATTCTCTTCAGCATCTCGAGATGCTGAAGAGAATTTCTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122316    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152446.2-1138s1c1
Sequence:CCGGCGAAAGGGTTTACAGCATCAACTCGAGTTGATGCTGTAAACCCTTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121946    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152446.2-3532s1c1
Sequence:CCGGCCAGATTATCTAACAGACATACTCGAGTATGTCTGTTAGATAATCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145613    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152446.2-3612s1c1
Sequence:CCGGCCTTGTGAATGGTAAACCAATCTCGAGATTGGTTTACCATTCACAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152446.2-2113s1c1
Sequence:CCGGGCTAATAAATTGGCTGAGGAACTCGAGTTCCTCAGCCAATTTATTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_152446.2-1679s1c1
Sequence:CCGGCGTTGGAGAAACAATCTGAAACTCGAGTTTCAGATTGTTTCTCCAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144260    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152446.2-3849s1c1
Sequence:CCGGCTTTAGATTCAGGGAGCATTTCTCGAGAAATGCTCCCTGAATCTAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152446.2-2773s1c1
Sequence:CCGGGCAGAAAGCAAGACTAAACTTCTCGAGAAGTTTAGTCTTGCTTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145095    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152446.2-3676s1c1
Sequence:CCGGGCAACTTATACTAGCACAGAACTCGAGTTCTGTGCTAGTATAAGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152446.2-766s1c1
Sequence:CCGGGCTTTGGAAGAATTGACTGAACTCGAGTTCAGTCAATTCTTCCAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152446.2-1038s1c1
Sequence:CCGGGCTATCTCGAAGGTTATTGAACTCGAGTTCAATAACCTTCGAGATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152446
VALIDATED
CEP128 MISSION shRNA Lentiviral Transduction Particles
centrosomal protein 128kDa
Human
18 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000451162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152446.3-1807s21c1
Sequence:CCGGTTGAATGATGTCCTAACAAAGCTCGAGCTTTGTTAGGACATCATTCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152446.3-1860s21c1
Sequence:CCGGGGAGGAGAAATTACGTGATATCTCGAGATATCACGTAATTTCTCCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000448127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152446.3-1936s21c1
Sequence:CCGGCATAGACTGGAGAGCGAATTGCTCGAGCAATTCGCTCTCCAGTCTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_152446.2-354s1c1
Sequence:CCGGGCTTGGACGATACCGAGAATACTCGAGTATTCTCGGTATCGTCCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152446.2-2316s1c1
Sequence:CCGGCCAGGAGCTTATGAAGCACTTCTCGAGAAGTGCTTCATAAGCTCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152446.2-2627s1c1
Sequence:CCGGGCTTGGAGACTGAACAGGAATCTCGAGATTCCTGTTCAGTCTCCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142061    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152446.2-3317s1c1
Sequence:CCGGGCTTCCTGTCTAGTCCAAGATCTCGAGATCTTGGACTAGACAGGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_152446.2-3184s1c1
Sequence:CCGGCGCAGAAATTCTCTTCAGCATCTCGAGATGCTGAAGAGAATTTCTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122316    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152446.2-1138s1c1
Sequence:CCGGCGAAAGGGTTTACAGCATCAACTCGAGTTGATGCTGTAAACCCTTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121946    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152446.2-3532s1c1
Sequence:CCGGCCAGATTATCTAACAGACATACTCGAGTATGTCTGTTAGATAATCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145613    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152446.2-3612s1c1
Sequence:CCGGCCTTGTGAATGGTAAACCAATCTCGAGATTGGTTTACCATTCACAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152446.2-2113s1c1
Sequence:CCGGGCTAATAAATTGGCTGAGGAACTCGAGTTCCTCAGCCAATTTATTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_152446.2-1679s1c1
Sequence:CCGGCGTTGGAGAAACAATCTGAAACTCGAGTTTCAGATTGTTTCTCCAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144260    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152446.2-3849s1c1
Sequence:CCGGCTTTAGATTCAGGGAGCATTTCTCGAGAAATGCTCCCTGAATCTAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152446.2-2773s1c1
Sequence:CCGGGCAGAAAGCAAGACTAAACTTCTCGAGAAGTTTAGTCTTGCTTTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145095    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152446.2-3676s1c1
Sequence:CCGGGCAACTTATACTAGCACAGAACTCGAGTTCTGTGCTAGTATAAGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152446.2-766s1c1
Sequence:CCGGGCTTTGGAAGAATTGACTGAACTCGAGTTCAGTCAATTCTTCCAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152446.2-1038s1c1
Sequence:CCGGGCTATCTCGAAGGTTATTGAACTCGAGTTCAATAACCTTCGAGATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181815
CEP128 MISSION shRNA Bacterial Glycerol Stock
centrosomal protein 128kDa
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241430    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181815.3-3780s21c1
Sequence:CCGGGCGACTTCACTTGAGTATTTCCTCGAGGAAATACTCAAGTGAAGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181815.3-2393s21c1
Sequence:CCGGCCGAGCAGATCTCGCTAATAACTCGAGTTATTAGCGAGATCTGCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217571    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181815.3-3780s1c1
Sequence:CCGGGCGACTTCACTTGAGTATTTCCTCGAGGAAATACTCAAGTGAAGTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181815.3-709s21c1
Sequence:CCGGAGGATTTGGAGCAGTCAATAACTCGAGTTATTGACTGCTCCAAATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181815.3-3633s21c1
Sequence:CCGGTCACACTCCTTGCCAGTATTTCTCGAGAAATACTGGCAAGGAGTGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181815.3-1255s21c1
Sequence:CCGGATGAGAATGAGGACGTAATAACTCGAGTTATTACGTCCTCATTCTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192531    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181815.1-1064s1c1
Sequence:CCGGGCAGGAAATAGAACGAGAGATCTCGAGATCTCTCGTTCTATTTCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190781    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181815.1-1214s1c1
Sequence:CCGGGCGACAAAGTGAAACCGAGAACTCGAGTTCTCGGTTTCACTTTGTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191955    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181815.1-989s1c1
Sequence:CCGGGTTAGAAGAATTGACTGGGAACTCGAGTTCCCAGTCAATTCTTCTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181815
CEP128 MISSION shRNA shRNA Plasmid DNA
centrosomal protein 128kDa
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241430    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181815.3-3780s21c1
Sequence:CCGGGCGACTTCACTTGAGTATTTCCTCGAGGAAATACTCAAGTGAAGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181815.3-2393s21c1
Sequence:CCGGCCGAGCAGATCTCGCTAATAACTCGAGTTATTAGCGAGATCTGCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217571    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181815.3-3780s1c1
Sequence:CCGGGCGACTTCACTTGAGTATTTCCTCGAGGAAATACTCAAGTGAAGTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181815.3-709s21c1
Sequence:CCGGAGGATTTGGAGCAGTCAATAACTCGAGTTATTGACTGCTCCAAATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181815.3-3633s21c1
Sequence:CCGGTCACACTCCTTGCCAGTATTTCTCGAGAAATACTGGCAAGGAGTGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181815.3-1255s21c1
Sequence:CCGGATGAGAATGAGGACGTAATAACTCGAGTTATTACGTCCTCATTCTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192531    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181815.1-1064s1c1
Sequence:CCGGGCAGGAAATAGAACGAGAGATCTCGAGATCTCTCGTTCTATTTCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190781    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181815.1-1214s1c1
Sequence:CCGGGCGACAAAGTGAAACCGAGAACTCGAGTTCTCGGTTTCACTTTGTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191955    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181815.1-989s1c1
Sequence:CCGGGTTAGAAGAATTGACTGGGAACTCGAGTTCCCAGTCAATTCTTCTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181815
CEP128 MISSION shRNA Lentiviral Transduction Particles
centrosomal protein 128kDa
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241430    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181815.3-3780s21c1
Sequence:CCGGGCGACTTCACTTGAGTATTTCCTCGAGGAAATACTCAAGTGAAGTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181815.3-2393s21c1
Sequence:CCGGCCGAGCAGATCTCGCTAATAACTCGAGTTATTAGCGAGATCTGCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217571    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181815.3-3780s1c1
Sequence:CCGGGCGACTTCACTTGAGTATTTCCTCGAGGAAATACTCAAGTGAAGTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181815.3-709s21c1
Sequence:CCGGAGGATTTGGAGCAGTCAATAACTCGAGTTATTGACTGCTCCAAATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181815.3-3633s21c1
Sequence:CCGGTCACACTCCTTGCCAGTATTTCTCGAGAAATACTGGCAAGGAGTGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181815.3-1255s21c1
Sequence:CCGGATGAGAATGAGGACGTAATAACTCGAGTTATTACGTCCTCATTCTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192531    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181815.1-1064s1c1
Sequence:CCGGGCAGGAAATAGAACGAGAGATCTCGAGATCTCTCGTTCTATTTCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190781    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181815.1-1214s1c1
Sequence:CCGGGCGACAAAGTGAAACCGAGAACTCGAGTTCTCGGTTTCACTTTGTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191955    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181815.1-989s1c1
Sequence:CCGGGTTAGAAGAATTGACTGGGAACTCGAGTTCCCAGTCAATTCTTCTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)