EMAIL THIS PAGE TO A FRIEND

CEP135

centrosomal protein 135kDa

69 Gene Product Result for
Synonyms: CEP4 KIAA0635 MCPH8
UniProtKB ID: Q66GS9, B2RMY0, O75130, Q58F25, Q9H8H7
Gene ID:
Human(9662) Summary: This gene encodes a centrosomal protein, which acts as a scaffolding protein during early centriole biogenesis, and is also required for centriole-centriole cohesion during interphase. Mutations in this gene are associated with autosomal recessive primary microcephaly-8. [provided by RefSeq, Jun 2012]
Mouse(381644) centrosomal protein 135
Rat(305288) centrosomal protein 135
Zebrafish(553303) centrosomal protein 135
cow(509483) centrosomal protein 135kDa
Horse(100058972) centrosomal protein 135kDa
dog(482157) centrosomal protein 135kDa
chicken(422746) centrosomal protein 135kDa
fruit fly(39647) CG17081 gene product from transcript CG17081-RB
domestic guinea pig(100727226) centrosomal protein 135kDa
naked mole-rat(101724897) centrosomal protein 135kDa
sheep(101108311) centrosomal protein 135kDa
Domestic Rabbit(100344751) centrosomal protein 135kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_199032 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_199032 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_199032 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_025009 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025009 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025009 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025009 Rosetta Predictions human pricing
XM_001076228 Rosetta Predictions rat pricing
XM_223341 Rosetta Predictions rat pricing
NM_199032 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025009 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00357669 predicted 3183
2 SASI_Hs01_00208415 predicted 343
3 SASI_Hs01_00208416 predicted 1131
4 SASI_Hs01_00208419 predicted 565
5 SASI_Hs01_00208420 predicted 3370
6 SASI_Hs02_00357670 predicted 1196
7 SASI_Hs02_00357671 predicted 3676
8 SASI_Hs02_00357672 predicted 593
9 SASI_Hs02_00357673 predicted 3190
10 SASI_Hs01_00208423 predicted 244
11 SASI_Hs01_00208414 predicted 1296
12 SASI_Hs01_00208417 predicted 1115
13 SASI_Hs01_00208418 predicted 2359
14 SASI_Hs01_00208421 predicted 2352
15 SASI_Hs01_00208422 predicted 3050
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076228 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00352470 predicted 2592
2 SASI_Rn02_00352471 predicted 3032
3 SASI_Rn02_00352472 predicted 1406
4 SASI_Rn02_00352473 predicted 224
5 SASI_Rn02_00352474 predicted 3137
6 SASI_Rn02_00352475 predicted 2340
7 SASI_Rn02_00352476 predicted 2352
8 SASI_Rn02_00352477 predicted 2140
9 SASI_Rn02_00352478 predicted 3089
10 SASI_Rn02_00352479 predicted 2281
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_223341 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00381285 predicted 2594
2 SASI_Rn02_00381286 predicted 2815
3 SASI_Rn02_00381287 predicted 1134
4 SASI_Rn02_00381288 predicted 1409
5 SASI_Rn02_00381289 predicted 232
6 SASI_Rn02_00381290 predicted 2336
7 SASI_Rn02_00381291 predicted 2353
8 SASI_Rn02_00381292 predicted 2134
9 SASI_Rn02_00381293 predicted 241
10 SASI_Rn02_00381294 predicted 1953
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199032 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00162135 predicted 1152
2 SASI_Mm02_00351309 predicted 1375
3 SASI_Mm02_00351310 predicted 1670
4 SASI_Mm01_00162136 predicted 922
5 SASI_Mm01_00162137 predicted 3299
6 SASI_Mm01_00162139 predicted 3286
7 SASI_Mm01_00162140 predicted 1433
8 SASI_Mm01_00162142 predicted 2033
9 SASI_Mm02_00351311 predicted 3077
10 SASI_Mm01_00162143 predicted 1152
11 SASI_Mm01_00162138 predicted 1691
12 SASI_Mm01_00162141 predicted 649
13 SASI_Mm01_00162144 predicted 299
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199032
CEP135 MISSION shRNA Bacterial Glycerol Stock
centrosomal protein 135kDa
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199032.1-3340s1c1
Sequence:CCGGGCAGATGTCAAACGAGAAGTACTCGAGTACTTCTCGTTTGACATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199032.1-412s1c1
Sequence:CCGGCCAGTATGTTCACAAGGTCAACTCGAGTTGACCTTGTGAACATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102215    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199032.1-3794s1c1
Sequence:CCGGGCTTTAATAATCTGTGCCTTACTCGAGTAAGGCACAGATTATTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199032.1-1764s1c1
Sequence:CCGGGCGCGTTATCTGAGTTGAGAACTCGAGTTCTCAACTCAGATAACGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199032.1-1453s1c1
Sequence:CCGGGCGGAGATCTTGTGCGATTAACTCGAGTTAATCGCACAAGATCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000446403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199032.2-1001s21c1
Sequence:CCGGTAACCGAGATCGACCAGTTAGCTCGAGCTAACTGGTCGATCTCGGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000446407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199032.2-1392s21c1
Sequence:CCGGCATAGAGGAAGAGCGCGATTACTCGAGTAATCGCGCTCTTCCTCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428066    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199032.2-3835s21c1
Sequence:CCGGGAAGGATTCTTGCACTATTTACTCGAGTAAATAGTGCAAGAATCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199032
CEP135 MISSION shRNA shRNA Plasmid DNA
centrosomal protein 135kDa
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199032.1-3340s1c1
Sequence:CCGGGCAGATGTCAAACGAGAAGTACTCGAGTACTTCTCGTTTGACATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199032.1-412s1c1
Sequence:CCGGCCAGTATGTTCACAAGGTCAACTCGAGTTGACCTTGTGAACATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102215    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199032.1-3794s1c1
Sequence:CCGGGCTTTAATAATCTGTGCCTTACTCGAGTAAGGCACAGATTATTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199032.1-1764s1c1
Sequence:CCGGGCGCGTTATCTGAGTTGAGAACTCGAGTTCTCAACTCAGATAACGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199032.1-1453s1c1
Sequence:CCGGGCGGAGATCTTGTGCGATTAACTCGAGTTAATCGCACAAGATCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000446403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199032.2-1001s21c1
Sequence:CCGGTAACCGAGATCGACCAGTTAGCTCGAGCTAACTGGTCGATCTCGGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000446407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199032.2-1392s21c1
Sequence:CCGGCATAGAGGAAGAGCGCGATTACTCGAGTAATCGCGCTCTTCCTCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428066    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199032.2-3835s21c1
Sequence:CCGGGAAGGATTCTTGCACTATTTACTCGAGTAAATAGTGCAAGAATCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199032
CEP135 MISSION shRNA Lentiviral Transduction Particles
centrosomal protein 135kDa
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199032.1-3340s1c1
Sequence:CCGGGCAGATGTCAAACGAGAAGTACTCGAGTACTTCTCGTTTGACATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199032.1-412s1c1
Sequence:CCGGCCAGTATGTTCACAAGGTCAACTCGAGTTGACCTTGTGAACATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102215    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199032.1-3794s1c1
Sequence:CCGGGCTTTAATAATCTGTGCCTTACTCGAGTAAGGCACAGATTATTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199032.1-1764s1c1
Sequence:CCGGGCGCGTTATCTGAGTTGAGAACTCGAGTTCTCAACTCAGATAACGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199032.1-1453s1c1
Sequence:CCGGGCGGAGATCTTGTGCGATTAACTCGAGTTAATCGCACAAGATCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000446403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199032.2-1001s21c1
Sequence:CCGGTAACCGAGATCGACCAGTTAGCTCGAGCTAACTGGTCGATCTCGGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000446407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199032.2-1392s21c1
Sequence:CCGGCATAGAGGAAGAGCGCGATTACTCGAGTAATCGCGCTCTTCCTCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428066    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199032.2-3835s21c1
Sequence:CCGGGAAGGATTCTTGCACTATTTACTCGAGTAAATAGTGCAAGAATCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025009
CEP135 MISSION shRNA Bacterial Glycerol Stock
centrosomal protein 135kDa
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156122    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025009.2-961s1c1
Sequence:CCGGCGACTGTCAGTTGCTTTGGATCTCGAGATCCAAAGCAACTGACAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154108    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025009.2-769s1c1
Sequence:CCGGCCCTCTGAAGTCAGTTCATATCTCGAGATATGAACTGACTTCAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025009.2-3333s1c1
Sequence:CCGGCGAATCATTGTTGGCTACAAACTCGAGTTTGTAGCCAACAATGATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025009.2-525s1c1
Sequence:CCGGCCAACACGTTAAAGAGTTGAACTCGAGTTCAACTCTTTAACGTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151250    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025009.2-4250s1c1
Sequence:CCGGGCCATCTAGAAGAACTATGATCTCGAGATCATAGTTCTTCTAGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151653    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025009.2-2956s1c1
Sequence:CCGGCGACTGGAACTTCTTTCTATTCTCGAGAATAGAAAGAAGTTCCAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153772    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025009.2-3625s1c1
Sequence:CCGGCCTTCACATTCTCCTGAACATCTCGAGATGTTCAGGAGAATGTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025009.2-2275s1c1
Sequence:CCGGGATGACTATCAGCACCGACTTCTCGAGAAGTCGGTGCTGATAGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025009.2-3481s1c1
Sequence:CCGGCGAGCTAAAGTGGCACAGTTACTCGAGTAACTGTGCCACTTTAGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025009
CEP135 MISSION shRNA shRNA Plasmid DNA
centrosomal protein 135kDa
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156122    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025009.2-961s1c1
Sequence:CCGGCGACTGTCAGTTGCTTTGGATCTCGAGATCCAAAGCAACTGACAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154108    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025009.2-769s1c1
Sequence:CCGGCCCTCTGAAGTCAGTTCATATCTCGAGATATGAACTGACTTCAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025009.2-3333s1c1
Sequence:CCGGCGAATCATTGTTGGCTACAAACTCGAGTTTGTAGCCAACAATGATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025009.2-525s1c1
Sequence:CCGGCCAACACGTTAAAGAGTTGAACTCGAGTTCAACTCTTTAACGTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151250    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025009.2-4250s1c1
Sequence:CCGGGCCATCTAGAAGAACTATGATCTCGAGATCATAGTTCTTCTAGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151653    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025009.2-2956s1c1
Sequence:CCGGCGACTGGAACTTCTTTCTATTCTCGAGAATAGAAAGAAGTTCCAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153772    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025009.2-3625s1c1
Sequence:CCGGCCTTCACATTCTCCTGAACATCTCGAGATGTTCAGGAGAATGTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025009.2-2275s1c1
Sequence:CCGGGATGACTATCAGCACCGACTTCTCGAGAAGTCGGTGCTGATAGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025009.2-3481s1c1
Sequence:CCGGCGAGCTAAAGTGGCACAGTTACTCGAGTAACTGTGCCACTTTAGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025009
CEP135 MISSION shRNA Lentiviral Transduction Particles
centrosomal protein 135kDa
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156122    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025009.2-961s1c1
Sequence:CCGGCGACTGTCAGTTGCTTTGGATCTCGAGATCCAAAGCAACTGACAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154108    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025009.2-769s1c1
Sequence:CCGGCCCTCTGAAGTCAGTTCATATCTCGAGATATGAACTGACTTCAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025009.2-3333s1c1
Sequence:CCGGCGAATCATTGTTGGCTACAAACTCGAGTTTGTAGCCAACAATGATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025009.2-525s1c1
Sequence:CCGGCCAACACGTTAAAGAGTTGAACTCGAGTTCAACTCTTTAACGTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151250    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025009.2-4250s1c1
Sequence:CCGGGCCATCTAGAAGAACTATGATCTCGAGATCATAGTTCTTCTAGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151653    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025009.2-2956s1c1
Sequence:CCGGCGACTGGAACTTCTTTCTATTCTCGAGAATAGAAAGAAGTTCCAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153772    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025009.2-3625s1c1
Sequence:CCGGCCTTCACATTCTCCTGAACATCTCGAGATGTTCAGGAGAATGTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025009.2-2275s1c1
Sequence:CCGGGATGACTATCAGCACCGACTTCTCGAGAAGTCGGTGCTGATAGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025009.2-3481s1c1
Sequence:CCGGCGAGCTAAAGTGGCACAGTTACTCGAGTAACTGTGCCACTTTAGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks