EMAIL THIS PAGE TO A FRIEND

CEP152

centrosomal protein 152kDa

115 Gene Product Result for
Synonyms: MCPH4 MCPH9 SCKL5
UniProtKB ID: O94986, E7ER66, Q17RV1, Q6NTA0
Gene ID:
Human(22995) Summary: This gene encodes a protein that is thought to be involved with centrosome function. Mutations in this gene have been associated with primary microcephaly (MCPH4). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2010]
Mouse(99100) centrosomal protein 152
Rat(311391) centrosomal protein 152
sheep(101109362) centrosomal protein 152kDa
Domestic Rabbit(100339757) centrosomal protein 152kDa
naked mole-rat(101718142) centrosomal protein 152kDa
domestic guinea pig(101788436) centrosomal protein 152kDa
Zebrafish(565873) centrosomal protein 152kDa
chicken(415437) centrosomal protein 152kDa
dog(478294) centrosomal protein 152kDa
cow(536117) centrosomal protein 152kDa
Horse(100147473) centrosomal protein 152kDa
domestic cat(101099557) centrosomal protein 152kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001081091 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081091 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081091 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014985 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014985 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014985 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014985 Rosetta Predictions human pricing
XM_230555 Rosetta Predictions rat pricing
XR_009444 Rosetta Predictions rat pricing
NM_001081091 Rosetta Predictions mouse pricing
XM_130551 Rosetta Predictions mouse pricing
XM_901416 Rosetta Predictions mouse pricing
XM_901422 Rosetta Predictions mouse pricing
XM_901426 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014985 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00346724 predicted 2960
2 SASI_Hs01_00154704 predicted 1978
3 SASI_Hs01_00154705 predicted 3072
4 SASI_Hs02_00346725 predicted 4301
5 SASI_Hs02_00346726 predicted 583
6 SASI_Hs02_00346727 predicted 4621
7 SASI_Hs02_00346728 predicted 2360
8 SASI_Hs02_00346729 predicted 4211
9 SASI_Hs01_00154712 predicted 2532
10 SASI_Hs02_00346730 predicted 2357
11 SASI_Hs01_00154706 predicted 315
12 SASI_Hs01_00154707 predicted 917
13 SASI_Hs01_00154708 predicted 504
14 SASI_Hs01_00154709 predicted 2192
15 SASI_Hs01_00154710 predicted 3363
16 SASI_Hs01_00154711 predicted 1321
17 SASI_Hs01_00154713 predicted 2416
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_230555 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00386339 predicted 2818
2 SASI_Rn02_00386340 predicted 2471
3 SASI_Rn02_00386341 predicted 2818
4 SASI_Rn02_00386342 predicted 3320
5 SASI_Rn02_00386343 predicted 3273
6 SASI_Rn02_00386344 predicted 3388
7 SASI_Rn02_00386345 predicted 3211
8 SASI_Rn02_00386346 predicted 3325
9 SASI_Rn02_00386347 predicted 2695
10 SASI_Rn02_00386348 predicted 2459
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_009444 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00124423 predicted 2987
2 SASI_Rn01_00124425 predicted 5552
3 SASI_Rn02_00419750 predicted 5643
4 SASI_Rn01_00124426 predicted 5343
5 SASI_Rn01_00124427 predicted 5072
6 SASI_Rn01_00124428 predicted 5607
7 SASI_Rn01_00124429 predicted 5574
8 SASI_Rn02_00419751 predicted 5600
9 SASI_Rn02_00419752 predicted 4858
10 SASI_Rn01_00124430 predicted 5337
11 SASI_Rn01_00124422 predicted 4309
12 SASI_Rn01_00124424 predicted 732
13 SASI_Rn01_00124431 predicted 3497
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081091 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00295091 predicted 2861
2 SASI_Mm02_00295092 predicted 2024
3 SASI_Mm02_00295093 predicted 463
4 SASI_Mm02_00295094 predicted 1593
5 SASI_Mm02_00295095 predicted 5461
6 SASI_Mm02_00295096 predicted 1244
7 SASI_Mm02_00295097 predicted 5216
8 SASI_Mm02_00295098 predicted 3433
9 SASI_Mm02_00295099 predicted 594
10 SASI_Mm02_00295100 predicted 4293
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_130551 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00231070 predicted 2866
2 SASI_Mm01_00231071 predicted 4290
3 SASI_Mm01_00231072 predicted 2026
4 SASI_Mm01_00231073 predicted 2057
5 SASI_Mm01_00231074 predicted 468
6 SASI_Mm01_00231075 predicted 601
7 SASI_Mm01_00231076 predicted 1770
8 SASI_Mm01_00231077 predicted 5460
9 SASI_Mm01_00231078 predicted 1254
10 SASI_Mm01_00231079 predicted 5228
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901416 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00249567 predicted 515
2 SASI_Mm01_00249568 predicted 687
3 SASI_Mm01_00249569 predicted 1282
4 SASI_Mm01_00249570 predicted 705
5 SASI_Mm01_00249571 predicted 964
6 SASI_Mm01_00249572 predicted 1265
7 SASI_Mm01_00249573 predicted 1203
8 SASI_Mm01_00249574 predicted 835
9 SASI_Mm01_00249575 predicted 999
10 SASI_Mm01_00249576 predicted 1268
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901422 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00212850 predicted 2596
2 SASI_Mm01_00212851 predicted 4017
3 SASI_Mm01_00212852 predicted 1752
4 SASI_Mm01_00212853 predicted 5232
5 SASI_Mm01_00212854 predicted 1766
6 SASI_Mm01_00212855 predicted 1794
7 SASI_Mm01_00212856 predicted 3104
8 SASI_Mm01_00212857 predicted 5195
9 SASI_Mm01_00212858 predicted 4955
10 SASI_Mm01_00212859 predicted 3161
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901426 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00242319 predicted 2264
2 SASI_Mm01_00242320 predicted 3675
3 SASI_Mm01_00242321 predicted 1561
4 SASI_Mm01_00242322 predicted 1592
5 SASI_Mm01_00242323 predicted 218
6 SASI_Mm01_00242324 predicted 1294
7 SASI_Mm01_00242325 predicted 4857
8 SASI_Mm01_00242326 predicted 785
9 SASI_Mm01_00242327 predicted 4613
10 SASI_Mm01_00242328 predicted 2827
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081091
CEP152 MISSION shRNA Bacterial Glycerol Stock
centrosomal protein 152kDa
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081091.1-4275s21c1
Sequence:CCGGGCACGGAAGATGCGCAATTATCTCGAGATAATTGCGCATCTTCCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251327    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081091.1-5514s21c1
Sequence:CCGGTAATACTTGATGCTAACAAACCTCGAGGTTTGTTAGCATCAAGTATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081091.1-3281s21c1
Sequence:CCGGTTTAGAGGATCATCGAAATAACTCGAGTTATTTCGATGATCCTCTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081091.1-765s21c1
Sequence:CCGGGGAGCTTTGGAGCCGTATAAACTCGAGTTTATACGGCTCCAAAGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081091.1-4188s21c1
Sequence:CCGGCGTGACATGCTTCGGTATATTCTCGAGAATATACCGAAGCATGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081091
CEP152 MISSION shRNA shRNA Plasmid DNA
centrosomal protein 152kDa
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081091.1-4275s21c1
Sequence:CCGGGCACGGAAGATGCGCAATTATCTCGAGATAATTGCGCATCTTCCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251327    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081091.1-5514s21c1
Sequence:CCGGTAATACTTGATGCTAACAAACCTCGAGGTTTGTTAGCATCAAGTATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081091.1-3281s21c1
Sequence:CCGGTTTAGAGGATCATCGAAATAACTCGAGTTATTTCGATGATCCTCTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081091.1-765s21c1
Sequence:CCGGGGAGCTTTGGAGCCGTATAAACTCGAGTTTATACGGCTCCAAAGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081091.1-4188s21c1
Sequence:CCGGCGTGACATGCTTCGGTATATTCTCGAGAATATACCGAAGCATGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081091
CEP152 MISSION shRNA Lentiviral Transduction Particles
centrosomal protein 152kDa
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081091.1-4275s21c1
Sequence:CCGGGCACGGAAGATGCGCAATTATCTCGAGATAATTGCGCATCTTCCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251327    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081091.1-5514s21c1
Sequence:CCGGTAATACTTGATGCTAACAAACCTCGAGGTTTGTTAGCATCAAGTATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081091.1-3281s21c1
Sequence:CCGGTTTAGAGGATCATCGAAATAACTCGAGTTATTTCGATGATCCTCTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081091.1-765s21c1
Sequence:CCGGGGAGCTTTGGAGCCGTATAAACTCGAGTTTATACGGCTCCAAAGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081091.1-4188s21c1
Sequence:CCGGCGTGACATGCTTCGGTATATTCTCGAGAATATACCGAAGCATGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014985
CEP152 MISSION shRNA Bacterial Glycerol Stock
centrosomal protein 152kDa
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014985.1-880s1c1
Sequence:CCGGGCATTGTTATGGGCCTCACAACTCGAGTTGTGAGGCCCATAACAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014985.1-3720s1c1
Sequence:CCGGGCCCGAAAGATGCGCAAATATCTCGAGATATTTGCGCATCTTTCGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133684    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014985.1-909s1c1
Sequence:CCGGGAAGAGCAAGTATTGTCCTTACTCGAGTAAGGACAATACTTGCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134042    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014985.1-3818s1c1
Sequence:CCGGCAAACTTGCTACAATGGCAAACTCGAGTTTGCCATTGTAGCAAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014985.1-732s1c1
Sequence:CCGGGAGACTCAGATACAAGCATTACTCGAGTAATGCTTGTATCTGAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014985.1-1313s1c1
Sequence:CCGGCACTGAATCGTATGTGGATTTCTCGAGAAATCCACATACGATTCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135839    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014985.1-4107s1c1
Sequence:CCGGCCATCCCTCGAAATGATAGAACTCGAGTTCTATCATTTCGAGGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136320    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014985.1-4079s1c1
Sequence:CCGGCATGCCCATCAGTTTCCTATTCTCGAGAATAGGAAACTGATGGGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014985.1-2173s1c1
Sequence:CCGGGCAGCCAAACTGACCAAGTAACTCGAGTTACTTGGTCAGTTTGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014985
CEP152 MISSION shRNA shRNA Plasmid DNA
centrosomal protein 152kDa
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014985.1-880s1c1
Sequence:CCGGGCATTGTTATGGGCCTCACAACTCGAGTTGTGAGGCCCATAACAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014985.1-3720s1c1
Sequence:CCGGGCCCGAAAGATGCGCAAATATCTCGAGATATTTGCGCATCTTTCGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133684    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014985.1-909s1c1
Sequence:CCGGGAAGAGCAAGTATTGTCCTTACTCGAGTAAGGACAATACTTGCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134042    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014985.1-3818s1c1
Sequence:CCGGCAAACTTGCTACAATGGCAAACTCGAGTTTGCCATTGTAGCAAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014985.1-732s1c1
Sequence:CCGGGAGACTCAGATACAAGCATTACTCGAGTAATGCTTGTATCTGAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014985.1-1313s1c1
Sequence:CCGGCACTGAATCGTATGTGGATTTCTCGAGAAATCCACATACGATTCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135839    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014985.1-4107s1c1
Sequence:CCGGCCATCCCTCGAAATGATAGAACTCGAGTTCTATCATTTCGAGGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136320    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014985.1-4079s1c1
Sequence:CCGGCATGCCCATCAGTTTCCTATTCTCGAGAATAGGAAACTGATGGGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014985.1-2173s1c1
Sequence:CCGGGCAGCCAAACTGACCAAGTAACTCGAGTTACTTGGTCAGTTTGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014985
CEP152 MISSION shRNA Lentiviral Transduction Particles
centrosomal protein 152kDa
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014985.1-880s1c1
Sequence:CCGGGCATTGTTATGGGCCTCACAACTCGAGTTGTGAGGCCCATAACAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014985.1-3720s1c1
Sequence:CCGGGCCCGAAAGATGCGCAAATATCTCGAGATATTTGCGCATCTTTCGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133684    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014985.1-909s1c1
Sequence:CCGGGAAGAGCAAGTATTGTCCTTACTCGAGTAAGGACAATACTTGCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134042    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014985.1-3818s1c1
Sequence:CCGGCAAACTTGCTACAATGGCAAACTCGAGTTTGCCATTGTAGCAAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014985.1-732s1c1
Sequence:CCGGGAGACTCAGATACAAGCATTACTCGAGTAATGCTTGTATCTGAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014985.1-1313s1c1
Sequence:CCGGCACTGAATCGTATGTGGATTTCTCGAGAAATCCACATACGATTCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135839    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014985.1-4107s1c1
Sequence:CCGGCCATCCCTCGAAATGATAGAACTCGAGTTCTATCATTTCGAGGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136320    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014985.1-4079s1c1
Sequence:CCGGCATGCCCATCAGTTTCCTATTCTCGAGAATAGGAAACTGATGGGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014985.1-2173s1c1
Sequence:CCGGGCAGCCAAACTGACCAAGTAACTCGAGTTACTTGGTCAGTTTGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks