EMAIL THIS PAGE TO A FRIEND

CEP164

centrosomal protein 164kDa

Synonyms: NPHP15
UniProtKB ID: Q9UPV0, Q6PKH9, Q7Z2X9, Q9NVS0, Q9UFJ6
Gene ID:
Human(22897) Summary: This gene encodes a centrosomal protein involved in microtubule organization, DNA damage response, and chromosome segregation. The encoded protein is required for assembly of primary cilia and localizes to mature centrioles. Defects in this gene are a cause of nephronophthisis-related ciliopathies. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]
Mouse(214552) centrosomal protein 164
Rat(363055) centrosomal protein 164
chicken(419769) centrosomal protein 164kDa
cow(514284) centrosomal protein 164kDa
Horse(100062791) centrosomal protein 164kDa
domestic cat(101082089) centrosomal protein 164kDa
dog(489389) centrosomal protein 164kDa
domestic guinea pig(100730829) centrosomal protein 164kDa
naked mole-rat(101701550) centrosomal protein 164kDa
sheep(101112846) centrosomal protein 164kDa
138 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_374936 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_374936 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_374936 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_014956 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014956 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014956 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081373 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081373 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081373 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014956 Rosetta Predictions human pricing
XM_001064241 Rosetta Predictions rat pricing
XM_343383 Rosetta Predictions rat pricing
NM_001081373 Rosetta Predictions mouse pricing
XM_001000585 Rosetta Predictions mouse pricing
XM_901585 Rosetta Predictions mouse pricing
XM_901588 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014956 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00125934 predicted 2320
2 SASI_Hs02_00346636 predicted 4361
3 SASI_Hs01_00125935 predicted 2064
4 SASI_Hs01_00125936 predicted 1290
5 SASI_Hs01_00125938 predicted 2724
6 SASI_Hs01_00125939 predicted 2195
7 SASI_Hs01_00125940 predicted 1098
8 SASI_Hs01_00125941 predicted 3948
9 SASI_Hs01_00125942 predicted 2608
10 SASI_Hs01_00125943 predicted 3123
11 SASI_Hs01_00125937 predicted 4433
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064241 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00309774 predicted 235
2 SASI_Rn02_00309775 predicted 3875
3 SASI_Rn02_00309776 predicted 4470
4 SASI_Rn02_00309777 predicted 3362
5 SASI_Rn02_00309778 predicted 3018
6 SASI_Rn02_00309779 predicted 4488
7 SASI_Rn02_00309780 predicted 3007
8 SASI_Rn02_00309781 predicted 2631
9 SASI_Rn02_00309782 predicted 1380
10 SASI_Rn02_00309783 predicted 2337
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343383 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00395714 predicted 240
2 SASI_Rn02_00395715 predicted 3872
3 SASI_Rn02_00395716 predicted 4477
4 SASI_Rn02_00395717 predicted 3361
5 SASI_Rn02_00395718 predicted 3012
6 SASI_Rn02_00395719 predicted 4481
7 SASI_Rn02_00395720 predicted 3003
8 SASI_Rn02_00395721 predicted 2626
9 SASI_Rn02_00395722 predicted 1375
10 SASI_Rn02_00395723 predicted 2342
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081373 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00297781 predicted 3427
2 SASI_Mm02_00297782 predicted 3587
3 SASI_Mm02_00297783 predicted 2560
4 SASI_Mm02_00297784 predicted 3745
5 SASI_Mm02_00297785 predicted 2997
6 SASI_Mm02_00297786 predicted 4004
7 SASI_Mm02_00297787 predicted 3829
8 SASI_Mm02_00297788 predicted 3920
9 SASI_Mm02_00297789 predicted 2592
10 SASI_Mm02_00297790 predicted 273
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001000585 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00220776 predicted 4272
2 SASI_Mm01_00220777 predicted 3660
3 SASI_Mm01_00220778 predicted 3026
4 SASI_Mm01_00220779 predicted 3918
5 SASI_Mm01_00220780 predicted 3822
6 SASI_Mm01_00220781 predicted 3744
7 SASI_Mm01_00220782 predicted 3941
8 SASI_Mm01_00220783 predicted 3835
9 SASI_Mm01_00220784 predicted 3897
10 SASI_Mm01_00220785 predicted 4167
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901585 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00240659 predicted 4858
2 SASI_Mm01_00240660 predicted 4249
3 SASI_Mm01_00240661 predicted 3563
4 SASI_Mm01_00240662 predicted 4509
5 SASI_Mm01_00240663 predicted 4412
6 SASI_Mm01_00240664 predicted 4331
7 SASI_Mm01_00240665 predicted 4528
8 SASI_Mm01_00240666 predicted 4431
9 SASI_Mm01_00240667 predicted 4486
10 SASI_Mm01_00240668 predicted 4763
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901588 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00203868 predicted 4831
2 SASI_Mm01_00203869 predicted 4209
3 SASI_Mm01_00203870 predicted 3529
4 SASI_Mm01_00203871 predicted 4471
5 SASI_Mm01_00203872 predicted 4385
6 SASI_Mm01_00203873 predicted 4299
7 SASI_Mm01_00203874 predicted 4496
8 SASI_Mm01_00203875 predicted 4396
9 SASI_Mm01_00203876 predicted 4462
10 SASI_Mm01_00203877 predicted 4722
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_374936
VALIDATED
CEP164 MISSION shRNA Bacterial Glycerol Stock
centrosomal protein 164kDa
Human
1 Products Total
TRC Number Price Set Price (1)? Select
TRCN0000127595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:XM_374936.1-1292s1c1
Sequence:CCGGCCAGCCAAGAACTGGAAATTACTCGAGTAATTTCCAGTTCTTGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_374936
VALIDATED
CEP164 MISSION shRNA shRNA Plasmid DNA
centrosomal protein 164kDa
Human
1 Products Total
TRC Number Vector Price Set Price (1)? Select
TRCN0000127595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:XM_374936.1-1292s1c1
Sequence:CCGGCCAGCCAAGAACTGGAAATTACTCGAGTAATTTCCAGTTCTTGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_374936
VALIDATED
CEP164 MISSION shRNA Lentiviral Transduction Particles
centrosomal protein 164kDa
Human
1 Products Total
TRC Number Volume Titer Vector Price Set Price (1)? Select
TRCN0000127595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:XM_374936.1-1292s1c1
Sequence:CCGGCCAGCCAAGAACTGGAAATTACTCGAGTAATTTCCAGTTCTTGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014956
VALIDATED
CEP164 MISSION shRNA Bacterial Glycerol Stock
centrosomal protein 164kDa
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014956.3-3135s1c1
Sequence:CCGGGCTCCGAGAAATTCTTGATGACTCGAGTCATCAAGAATTTCTCGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147376    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_014956.3-5362s1c1
Sequence:CCGGGCATTGTTTCCATCTGTCTTTCTCGAGAAAGACAGATGGAAACAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_014956.3-3836s1c1
Sequence:CCGGGCAGTGAAAGTTCTGAATCTTCTCGAGAAGATTCAGAACTTTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014956.3-2920s1c1
Sequence:CCGGCAGGATTTAGAGTTGGACCTTCTCGAGAAGGTCCAACTCTAAATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000449839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014956.4-624s21c1
Sequence:CCGGTGCTCTTCGTGGATCTCAAAGCTCGAGCTTTGAGATCCACGAAGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000449371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014956.4-2735s21c1
Sequence:CCGGCTAAGGCCAGAGAGCAGTATGCTCGAGCATACTGCTCTCTGGCCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000443873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014956.4-4432s21c1
Sequence:CCGGTTACCTCTCTTCTCGTCAACACTCGAGTGTTGACGAGAAGAGAGGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014956
VALIDATED
CEP164 MISSION shRNA shRNA Plasmid DNA
centrosomal protein 164kDa
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014956.3-3135s1c1
Sequence:CCGGGCTCCGAGAAATTCTTGATGACTCGAGTCATCAAGAATTTCTCGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147376    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_014956.3-5362s1c1
Sequence:CCGGGCATTGTTTCCATCTGTCTTTCTCGAGAAAGACAGATGGAAACAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_014956.3-3836s1c1
Sequence:CCGGGCAGTGAAAGTTCTGAATCTTCTCGAGAAGATTCAGAACTTTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014956.3-2920s1c1
Sequence:CCGGCAGGATTTAGAGTTGGACCTTCTCGAGAAGGTCCAACTCTAAATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000449839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014956.4-624s21c1
Sequence:CCGGTGCTCTTCGTGGATCTCAAAGCTCGAGCTTTGAGATCCACGAAGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000449371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014956.4-2735s21c1
Sequence:CCGGCTAAGGCCAGAGAGCAGTATGCTCGAGCATACTGCTCTCTGGCCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000443873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014956.4-4432s21c1
Sequence:CCGGTTACCTCTCTTCTCGTCAACACTCGAGTGTTGACGAGAAGAGAGGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014956
VALIDATED
CEP164 MISSION shRNA Lentiviral Transduction Particles
centrosomal protein 164kDa
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014956.3-3135s1c1
Sequence:CCGGGCTCCGAGAAATTCTTGATGACTCGAGTCATCAAGAATTTCTCGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147376    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_014956.3-5362s1c1
Sequence:CCGGGCATTGTTTCCATCTGTCTTTCTCGAGAAAGACAGATGGAAACAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_014956.3-3836s1c1
Sequence:CCGGGCAGTGAAAGTTCTGAATCTTCTCGAGAAGATTCAGAACTTTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014956.3-2920s1c1
Sequence:CCGGCAGGATTTAGAGTTGGACCTTCTCGAGAAGGTCCAACTCTAAATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000449839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014956.4-624s21c1
Sequence:CCGGTGCTCTTCGTGGATCTCAAAGCTCGAGCTTTGAGATCCACGAAGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000449371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014956.4-2735s21c1
Sequence:CCGGCTAAGGCCAGAGAGCAGTATGCTCGAGCATACTGCTCTCTGGCCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000443873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014956.4-4432s21c1
Sequence:CCGGTTACCTCTCTTCTCGTCAACACTCGAGTGTTGACGAGAAGAGAGGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081373
VALIDATED
CEP164 MISSION shRNA Bacterial Glycerol Stock
centrosomal protein 164kDa
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000250944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081373.2-2273s21c1
Sequence:CCGGTTCACCAGGTGACCGAGTATGCTCGAGCATACTCGGTCACCTGGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250943    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081373.2-5240s21c1
Sequence:CCGGCACAGGGTCTCACCGATTTATCTCGAGATAAATCGGTGAGACCCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081373.2-3540s21c1
Sequence:CCGGTGATCCCAACAAGATCCATTACTCGAGTAATGGATCTTGTTGGGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081373.2-4097s21c1
Sequence:CCGGCAACAACCACATCGAACTTATCTCGAGATAAGTTCGATGTGGTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000258105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081373.2-3854s21c1
Sequence:CCGGTGGAGAAGTGGCGCAAGTATTCTCGAGAATACTTGCGCCACTTCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081373
VALIDATED
CEP164 MISSION shRNA shRNA Plasmid DNA
centrosomal protein 164kDa
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000250944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081373.2-2273s21c1
Sequence:CCGGTTCACCAGGTGACCGAGTATGCTCGAGCATACTCGGTCACCTGGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250943    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081373.2-5240s21c1
Sequence:CCGGCACAGGGTCTCACCGATTTATCTCGAGATAAATCGGTGAGACCCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081373.2-3540s21c1
Sequence:CCGGTGATCCCAACAAGATCCATTACTCGAGTAATGGATCTTGTTGGGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081373.2-4097s21c1
Sequence:CCGGCAACAACCACATCGAACTTATCTCGAGATAAGTTCGATGTGGTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000258105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081373.2-3854s21c1
Sequence:CCGGTGGAGAAGTGGCGCAAGTATTCTCGAGAATACTTGCGCCACTTCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081373
VALIDATED
CEP164 MISSION shRNA Lentiviral Transduction Particles
centrosomal protein 164kDa
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000250944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081373.2-2273s21c1
Sequence:CCGGTTCACCAGGTGACCGAGTATGCTCGAGCATACTCGGTCACCTGGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250943    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081373.2-5240s21c1
Sequence:CCGGCACAGGGTCTCACCGATTTATCTCGAGATAAATCGGTGAGACCCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081373.2-3540s21c1
Sequence:CCGGTGATCCCAACAAGATCCATTACTCGAGTAATGGATCTTGTTGGGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081373.2-4097s21c1
Sequence:CCGGCAACAACCACATCGAACTTATCTCGAGATAAGTTCGATGTGGTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000258105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081373.2-3854s21c1
Sequence:CCGGTGGAGAAGTGGCGCAAGTATTCTCGAGAATACTTGCGCCACTTCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks