EMAIL THIS PAGE TO A FRIEND

CEP170

centrosomal protein 170kDa

260 Gene Product Result for
Synonyms: FAM68A KAB KIAA0470
Gene ID:
Human(9859) Summary: The product of this gene is a component of the centrosome, a non-membraneous organelle that functions as the major microtubule-organizing center in animal cells. During interphase, the encoded protein localizes to the sub-distal appendages of mature centrioles, which are microtubule-based structures thought to help organize centrosomes. During mitosis, the protein associates with spindle microtubules near the centrosomes. The protein interacts with and is phosphorylated by polo-like kinase 1, and functions in maintaining microtubule organization and cell morphology. The human genome contains a putative transcribed pseudogene. Several alternatively spliced transcript variants of this gene have been found, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008]
Mouse(545389) centrosomal protein 170
Rat(171457) centrosomal protein 170
chicken(421499) centrosomal protein 170kDa
dog(480096) centrosomal protein 170kDa
Horse(100054866) centrosomal protein 170kDa
cow(529230) centrosomal protein 170kDa
domestic cat(101089733) centrosomal protein 170kDa
sheep(101119149) centrosomal protein 170kDa
Domestic Rabbit(100342565) centrosomal protein 170kDa
naked mole-rat(101703041) centrosomal protein 170kDa
domestic guinea pig(100718787) centrosomal protein 170kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014812 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014812 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014812 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001099637 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001099637 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001099637 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042404 Rosetta Predictions human pricing
NM_001042405 Rosetta Predictions human pricing
NM_014812 Rosetta Predictions human pricing
NM_001099637 Rosetta Predictions mouse pricing
XM_989586 Rosetta Predictions mouse pricing
XM_989619 Rosetta Predictions mouse pricing
XM_989640 Rosetta Predictions mouse pricing
XM_989670 Rosetta Predictions mouse pricing
XM_989704 Rosetta Predictions mouse pricing
XM_989773 Rosetta Predictions mouse pricing
XM_989812 Rosetta Predictions mouse pricing
XM_989841 Rosetta Predictions mouse pricing
XM_989868 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042404 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00309558 predicted 1373
2 SASI_Hs02_00309559 predicted 2091
3 SASI_Hs02_00309560 predicted 500
4 SASI_Hs02_00309561 predicted 3534
5 SASI_Hs02_00309562 predicted 1177
6 SASI_Hs02_00309563 predicted 3353
7 SASI_Hs02_00309564 predicted 1013
8 SASI_Hs02_00309565 predicted 4570
9 SASI_Hs02_00309566 predicted 653
10 SASI_Hs02_00309567 predicted 739
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042405 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00309568 predicted 1374
2 SASI_Hs02_00309569 predicted 2096
3 SASI_Hs02_00309570 predicted 492
4 SASI_Hs02_00309571 predicted 3529
5 SASI_Hs02_00309572 predicted 1176
6 SASI_Hs02_00309573 predicted 3351
7 SASI_Hs02_00309574 predicted 1018
8 SASI_Hs02_00309575 predicted 4493
9 SASI_Hs02_00309576 predicted 652
10 SASI_Hs02_00309577 predicted 741
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014812 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00219612 predicted 1376
2 SASI_Hs01_00219613 predicted 2386
3 SASI_Hs02_00346338 predicted 492
4 SASI_Hs02_00346339 predicted 3823
5 SASI_Hs01_00219615 predicted 1176
6 SASI_Hs02_00346340 predicted 3648
7 SASI_Hs01_00219614 predicted 1019
8 SASI_Hs02_00346341 predicted 4865
9 SASI_Hs01_00219617 predicted 651
10 SASI_Hs01_00219620 predicted 738
11 SASI_Hs01_00219616 predicted 1819
12 SASI_Hs01_00219618 predicted 1537
13 SASI_Hs01_00219619 predicted 1550
14 SASI_Hs01_00219621 predicted 2098
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099637 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00301915 predicted 3861
2 SASI_Mm02_00301916 predicted 1913
3 SASI_Mm02_00301917 predicted 1891
4 SASI_Mm02_00301918 predicted 3518
5 SASI_Mm02_00301919 predicted 3591
6 SASI_Mm02_00301920 predicted 1986
7 SASI_Mm02_00301921 predicted 1656
8 SASI_Mm02_00301922 predicted 3736
9 SASI_Mm02_00301923 predicted 286
10 SASI_Mm02_00301924 predicted 2193
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_989586 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00241757 predicted 506
2 SASI_Mm01_00241758 predicted 528
3 SASI_Mm01_00241759 predicted 442
4 SASI_Mm01_00241760 predicted 516
5 SASI_Mm01_00241761 predicted 531
6 SASI_Mm01_00241762 predicted 527
7 SASI_Mm01_00241763 predicted 527
8 SASI_Mm01_00241764 predicted 488
9 SASI_Mm01_00241765 predicted 504
10 SASI_Mm01_00241766 predicted 451
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_989619 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00281818 predicted 884
2 SASI_Mm01_00281819 predicted 871
3 SASI_Mm01_00281820 predicted 552
4 SASI_Mm01_00281821 predicted 362
5 SASI_Mm01_00281822 predicted 980
6 SASI_Mm01_00281823 predicted 370
7 SASI_Mm01_00281824 predicted 347
8 SASI_Mm01_00281825 predicted 448
9 SASI_Mm01_00281826 predicted 472
10 SASI_Mm01_00281827 predicted 460
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_989640 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00241467 predicted 1057
2 SASI_Mm01_00241468 predicted 3251
3 SASI_Mm01_00241469 predicted 1311
4 SASI_Mm01_00241470 predicted 1289
5 SASI_Mm01_00241471 predicted 2916
6 SASI_Mm01_00241472 predicted 2991
7 SASI_Mm01_00241473 predicted 1183
8 SASI_Mm01_00241474 predicted 1196
9 SASI_Mm01_00241475 predicted 3135
10 SASI_Mm01_00241476 predicted 1583
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_989670 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00237077 predicted 1619
2 SASI_Mm01_00237078 predicted 1590
3 SASI_Mm01_00237079 predicted 1501
4 SASI_Mm01_00237080 predicted 1561
5 SASI_Mm01_00237081 predicted 1473
6 SASI_Mm01_00237082 predicted 1056
7 SASI_Mm01_00237083 predicted 1295
8 SASI_Mm01_00237084 predicted 889
9 SASI_Mm01_00237085 predicted 614
10 SASI_Mm01_00237086 predicted 580
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_989704 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00263529 predicted 1498
2 SASI_Mm01_00263530 predicted 1460
3 SASI_Mm01_00263531 predicted 1373
4 SASI_Mm01_00263532 predicted 1434
5 SASI_Mm01_00263533 predicted 1342
6 SASI_Mm01_00263534 predicted 938
7 SASI_Mm01_00263535 predicted 1160
8 SASI_Mm01_00263536 predicted 754
9 SASI_Mm01_00263537 predicted 524
10 SASI_Mm01_00263538 predicted 478
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_989773 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00232011 predicted 1890
2 SASI_Mm01_00232012 predicted 1856
3 SASI_Mm01_00232013 predicted 1765
4 SASI_Mm01_00232014 predicted 1828
5 SASI_Mm01_00232015 predicted 1734
6 SASI_Mm01_00232016 predicted 1331
7 SASI_Mm01_00232017 predicted 1559
8 SASI_Mm01_00232018 predicted 1148
9 SASI_Mm01_00232019 predicted 916
10 SASI_Mm01_00232020 predicted 871
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_989812 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00217848 predicted 2982
2 SASI_Mm01_00217849 predicted 1039
3 SASI_Mm01_00217850 predicted 1011
4 SASI_Mm01_00217851 predicted 2640
5 SASI_Mm01_00217852 predicted 2720
6 SASI_Mm01_00217853 predicted 1112
7 SASI_Mm01_00217854 predicted 905
8 SASI_Mm01_00217855 predicted 929
9 SASI_Mm01_00217856 predicted 2858
10 SASI_Mm01_00217857 predicted 1314
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_989841 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00244526 predicted 3111
2 SASI_Mm01_00244527 predicted 1161
3 SASI_Mm01_00244528 predicted 1148
4 SASI_Mm01_00244529 predicted 2764
5 SASI_Mm01_00244530 predicted 2844
6 SASI_Mm01_00244531 predicted 1241
7 SASI_Mm01_00244532 predicted 2995
8 SASI_Mm01_00244533 predicted 2518
9 SASI_Mm01_00244534 predicted 1439
10 SASI_Mm01_00244535 predicted 3141
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_989868 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00450147 predicted 333
2 SASI_Mm02_00450148 predicted 534
3 SASI_Mm01_00245132 predicted 504
4 SASI_Mm01_00245134 predicted 395
5 SASI_Mm01_00245135 predicted 418
6 SASI_Mm01_00245136 predicted 414
7 SASI_Mm01_00245137 predicted 351
8 SASI_Mm01_00245138 predicted 425
9 SASI_Mm01_00245139 predicted 355
10 SASI_Mm01_00245140 predicted 345
11 SASI_Mm01_00245133 predicted 703
12 SASI_Mm01_00245141 predicted 630
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014812
VALIDATED
CEP170 MISSION shRNA Bacterial Glycerol Stock
centrosomal protein 170kDa
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000296286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_014812.2-4100s21c1
Sequence:CCGGGGCGCTTTCCTACTGATTATGCTCGAGCATAATCAGTAGGAAAGCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296262    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014812.2-5308s21c1
Sequence:CCGGTGACGTATAATGTAGTATATCCTCGAGGATATACTACATTATACGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_014812.2-4073s21c1
Sequence:CCGGGCTCTGCTTCAGTAAATTCAACTCGAGTTGAATTTACTGAAGCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014812.2-3280s21c1
Sequence:CCGGAGTTTCACTAGCCTCTATAAACTCGAGTTTATAGAGGCTAGTGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_014812.2-3159s21c1
Sequence:CCGGACCAGATACTCCCAGTTATAACTCGAGTTATAACTGGGAGTATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_014812.1-3718s1c1
Sequence:CCGGGCTCTGCTTCAGTAAATTCAACTCGAGTTGAATTTACTGAAGCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014812.1-4710s1c1
Sequence:CCGGGCTGAATTTGAGAATGCTGAACTCGAGTTCAGCATTCTCAAATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123334    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014812.1-5141s1c1
Sequence:CCGGGCAAACTAAATAGCCAACATTCTCGAGAATGTTGGCTATTTAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_014812.1-155s1c1
Sequence:CCGGGCAGTCTCGTAGTGTGGATAACTCGAGTTATCCACACTACGAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_014812.1-3772s1c1
Sequence:CCGGCCTCAGAAGATGAATTTGGATCTCGAGATCCAAATTCATCTTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014812
VALIDATED
CEP170 MISSION shRNA shRNA Plasmid DNA
centrosomal protein 170kDa
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000296286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_014812.2-4100s21c1
Sequence:CCGGGGCGCTTTCCTACTGATTATGCTCGAGCATAATCAGTAGGAAAGCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296262    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014812.2-5308s21c1
Sequence:CCGGTGACGTATAATGTAGTATATCCTCGAGGATATACTACATTATACGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_014812.2-4073s21c1
Sequence:CCGGGCTCTGCTTCAGTAAATTCAACTCGAGTTGAATTTACTGAAGCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014812.2-3280s21c1
Sequence:CCGGAGTTTCACTAGCCTCTATAAACTCGAGTTTATAGAGGCTAGTGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_014812.2-3159s21c1
Sequence:CCGGACCAGATACTCCCAGTTATAACTCGAGTTATAACTGGGAGTATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_014812.1-3718s1c1
Sequence:CCGGGCTCTGCTTCAGTAAATTCAACTCGAGTTGAATTTACTGAAGCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014812.1-4710s1c1
Sequence:CCGGGCTGAATTTGAGAATGCTGAACTCGAGTTCAGCATTCTCAAATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123334    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014812.1-5141s1c1
Sequence:CCGGGCAAACTAAATAGCCAACATTCTCGAGAATGTTGGCTATTTAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_014812.1-155s1c1
Sequence:CCGGGCAGTCTCGTAGTGTGGATAACTCGAGTTATCCACACTACGAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_014812.1-3772s1c1
Sequence:CCGGCCTCAGAAGATGAATTTGGATCTCGAGATCCAAATTCATCTTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014812
VALIDATED
CEP170 MISSION shRNA Lentiviral Transduction Particles
centrosomal protein 170kDa
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000296286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_014812.2-4100s21c1
Sequence:CCGGGGCGCTTTCCTACTGATTATGCTCGAGCATAATCAGTAGGAAAGCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296262    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014812.2-5308s21c1
Sequence:CCGGTGACGTATAATGTAGTATATCCTCGAGGATATACTACATTATACGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_014812.2-4073s21c1
Sequence:CCGGGCTCTGCTTCAGTAAATTCAACTCGAGTTGAATTTACTGAAGCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014812.2-3280s21c1
Sequence:CCGGAGTTTCACTAGCCTCTATAAACTCGAGTTTATAGAGGCTAGTGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_014812.2-3159s21c1
Sequence:CCGGACCAGATACTCCCAGTTATAACTCGAGTTATAACTGGGAGTATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_014812.1-3718s1c1
Sequence:CCGGGCTCTGCTTCAGTAAATTCAACTCGAGTTGAATTTACTGAAGCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014812.1-4710s1c1
Sequence:CCGGGCTGAATTTGAGAATGCTGAACTCGAGTTCAGCATTCTCAAATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123334    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014812.1-5141s1c1
Sequence:CCGGGCAAACTAAATAGCCAACATTCTCGAGAATGTTGGCTATTTAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_014812.1-155s1c1
Sequence:CCGGGCAGTCTCGTAGTGTGGATAACTCGAGTTATCCACACTACGAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_014812.1-3772s1c1
Sequence:CCGGCCTCAGAAGATGAATTTGGATCTCGAGATCCAAATTCATCTTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001099637
VALIDATED
CEP170 MISSION shRNA Bacterial Glycerol Stock
centrosomal protein 170kDa
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001099637.2-4417s21c1
Sequence:CCGGGATTAGACAATCCATTGATAACTCGAGTTATCAATGGATTGTCTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001099637.2-4311s21c1
Sequence:CCGGCCGAGCATCCTGATCACTTAACTCGAGTTAAGTGATCAGGATGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001099637.2-3973s21c1
Sequence:CCGGTTCATTCAAGCACCGAATTAACTCGAGTTAATTCGGTGCTTGAATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243676    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001099637.2-5776s21c1
Sequence:CCGGATAGTTTAGGTGGAGTATATTCTCGAGAATATACTCCACCTAAACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001099637.2-3828s21c1
Sequence:CCGGGGCGCTTTCCTACTGATTATGCTCGAGCATAATCAGTAGGAAAGCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001099637
VALIDATED
CEP170 MISSION shRNA shRNA Plasmid DNA
centrosomal protein 170kDa
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001099637.2-4417s21c1
Sequence:CCGGGATTAGACAATCCATTGATAACTCGAGTTATCAATGGATTGTCTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001099637.2-4311s21c1
Sequence:CCGGCCGAGCATCCTGATCACTTAACTCGAGTTAAGTGATCAGGATGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001099637.2-3973s21c1
Sequence:CCGGTTCATTCAAGCACCGAATTAACTCGAGTTAATTCGGTGCTTGAATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243676    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001099637.2-5776s21c1
Sequence:CCGGATAGTTTAGGTGGAGTATATTCTCGAGAATATACTCCACCTAAACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001099637.2-3828s21c1
Sequence:CCGGGGCGCTTTCCTACTGATTATGCTCGAGCATAATCAGTAGGAAAGCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001099637
VALIDATED
CEP170 MISSION shRNA Lentiviral Transduction Particles
centrosomal protein 170kDa
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001099637.2-4417s21c1
Sequence:CCGGGATTAGACAATCCATTGATAACTCGAGTTATCAATGGATTGTCTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001099637.2-4311s21c1
Sequence:CCGGCCGAGCATCCTGATCACTTAACTCGAGTTAAGTGATCAGGATGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001099637.2-3973s21c1
Sequence:CCGGTTCATTCAAGCACCGAATTAACTCGAGTTAATTCGGTGCTTGAATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243676    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001099637.2-5776s21c1
Sequence:CCGGATAGTTTAGGTGGAGTATATTCTCGAGAATATACTCCACCTAAACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001099637.2-3828s21c1
Sequence:CCGGGGCGCTTTCCTACTGATTATGCTCGAGCATAATCAGTAGGAAAGCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks