EMAIL THIS PAGE TO A FRIEND

CEP170B

centrosomal protein 170B

72 Gene Product Result for
Synonyms: CEP170R FAM68C KIAA0284
UniProtKB ID: Q9Y4F5, Q2KHR7, Q86TI7
Gene ID:
Mouse(217882) centrosomal protein 170B
Rat(500726) centrosomal protein 170B
domestic guinea pig(100714999) centrosomal protein 170B
naked mole-rat(101699032) centrosomal protein 170B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001024602 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001024602 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001024602 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015005 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015005 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015005 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU002661 MISSION® esiRNA esiRNA targeting human KIAA0284 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001112726 Rosetta Predictions human pricing
NM_015005 Rosetta Predictions human pricing
XM_001072852 Rosetta Predictions rat pricing
XM_576105 Rosetta Predictions rat pricing
NM_001024602 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001112726 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00325485 predicted 3003
2 SASI_Hs02_00325486 predicted 3391
3 SASI_Hs02_00325487 predicted 4586
4 SASI_Hs02_00325488 predicted 4322
5 SASI_Hs02_00325489 predicted 4398
6 SASI_Hs02_00325490 predicted 5338
7 SASI_Hs02_00325491 predicted 1431
8 SASI_Hs02_00325492 predicted 3306
9 SASI_Hs02_00325493 predicted 4621
10 SASI_Hs02_00325494 predicted 3704
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015005 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00089199 predicted 2871
2 SASI_Hs01_00089200 predicted 3255
3 SASI_Hs01_00089201 predicted 4448
4 SASI_Hs01_00089202 predicted 4197
5 SASI_Hs02_00346776 predicted 4269
6 SASI_Hs01_00089204 predicted 5207
7 SASI_Hs01_00089205 predicted 1292
8 SASI_Hs01_00089206 predicted 3177
9 SASI_Hs01_00089207 predicted 4486
10 SASI_Hs02_00346777 predicted 3566
11 SASI_Hs01_00089203 predicted 367
12 SASI_Hs01_00089208 predicted 4416
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072852 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00340680 predicted 3532
2 SASI_Rn02_00340681 predicted 1139
3 SASI_Rn02_00340682 predicted 3133
4 SASI_Rn02_00340683 predicted 276
5 SASI_Rn02_00340684 predicted 3583
6 SASI_Rn02_00340685 predicted 328
7 SASI_Rn02_00340686 predicted 3773
8 SASI_Rn02_00340687 predicted 1345
9 SASI_Rn02_00340688 predicted 4456
10 SASI_Rn02_00340689 predicted 293
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576105 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00404782 predicted 983
2 SASI_Rn02_00404783 predicted 4330
3 SASI_Rn02_00404784 predicted 1937
4 SASI_Rn02_00404785 predicted 1072
5 SASI_Rn02_00404786 predicted 4384
6 SASI_Rn02_00404787 predicted 1128
7 SASI_Rn02_00404788 predicted 4576
8 SASI_Rn02_00404789 predicted 2145
9 SASI_Rn02_00404790 predicted 5253
10 SASI_Rn02_00404791 predicted 1094
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024602 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00066935 predicted 499
2 SASI_Mm01_00066937 predicted 3675
3 SASI_Mm01_00066938 predicted 4675
4 SASI_Mm02_00287625 predicted 4363
5 SASI_Mm01_00066939 predicted 1285
6 SASI_Mm01_00066940 predicted 419
7 SASI_Mm01_00066941 predicted 3154
8 SASI_Mm01_00066942 predicted 2245
9 SASI_Mm01_00066943 predicted 4549
10 SASI_Mm02_00287626 predicted 4598
11 SASI_Mm01_00066934 predicted 268
12 SASI_Mm01_00066936 predicted 4605
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001024602
VALIDATED
CEP170B MISSION shRNA Bacterial Glycerol Stock
centrosomal protein 170B
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000198282    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001024602.1-5795s1c1
Sequence:CCGGGCTCACTACTGGTTATGCTTTCTCGAGAAAGCATAACCAGTAGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198005    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024602.1-4581s1c1
Sequence:CCGGCATCCTGAAGACATCCAACAACTCGAGTTGTTGGATGTCTTCAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197837    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024602.1-451s1c1
Sequence:CCGGGATTCCAACATGTACGTGTTACTCGAGTAACACGTACATGTTGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024602.1-1380s1c1
Sequence:CCGGGCAAGCCTTTGTCATCGAGTTCTCGAGAACTCGATGACAAAGGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024602.1-1026s1c1
Sequence:CCGGCAAAGACCATATCACCAAGTTCTCGAGAACTTGGTGATATGGTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177713    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024602.1-6077s1c1
Sequence:CCGGCCCTGTTTACACTTAGCTGATCTCGAGATCAGCTAAGTGTAAACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024602.1-4552s1c1
Sequence:CCGGGCCAGAATCAACTCTGAGAATCTCGAGATTCTCAGAGTTGATTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001024602
VALIDATED
CEP170B MISSION shRNA shRNA Plasmid DNA
centrosomal protein 170B
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000198282    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001024602.1-5795s1c1
Sequence:CCGGGCTCACTACTGGTTATGCTTTCTCGAGAAAGCATAACCAGTAGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198005    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024602.1-4581s1c1
Sequence:CCGGCATCCTGAAGACATCCAACAACTCGAGTTGTTGGATGTCTTCAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197837    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024602.1-451s1c1
Sequence:CCGGGATTCCAACATGTACGTGTTACTCGAGTAACACGTACATGTTGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024602.1-1380s1c1
Sequence:CCGGGCAAGCCTTTGTCATCGAGTTCTCGAGAACTCGATGACAAAGGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024602.1-1026s1c1
Sequence:CCGGCAAAGACCATATCACCAAGTTCTCGAGAACTTGGTGATATGGTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177713    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024602.1-6077s1c1
Sequence:CCGGCCCTGTTTACACTTAGCTGATCTCGAGATCAGCTAAGTGTAAACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024602.1-4552s1c1
Sequence:CCGGGCCAGAATCAACTCTGAGAATCTCGAGATTCTCAGAGTTGATTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001024602
VALIDATED
CEP170B MISSION shRNA Lentiviral Transduction Particles
centrosomal protein 170B
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000198282    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001024602.1-5795s1c1
Sequence:CCGGGCTCACTACTGGTTATGCTTTCTCGAGAAAGCATAACCAGTAGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198005    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024602.1-4581s1c1
Sequence:CCGGCATCCTGAAGACATCCAACAACTCGAGTTGTTGGATGTCTTCAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197837    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024602.1-451s1c1
Sequence:CCGGGATTCCAACATGTACGTGTTACTCGAGTAACACGTACATGTTGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024602.1-1380s1c1
Sequence:CCGGGCAAGCCTTTGTCATCGAGTTCTCGAGAACTCGATGACAAAGGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024602.1-1026s1c1
Sequence:CCGGCAAAGACCATATCACCAAGTTCTCGAGAACTTGGTGATATGGTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177713    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024602.1-6077s1c1
Sequence:CCGGCCCTGTTTACACTTAGCTGATCTCGAGATCAGCTAAGTGTAAACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024602.1-4552s1c1
Sequence:CCGGGCCAGAATCAACTCTGAGAATCTCGAGATTCTCAGAGTTGATTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015005
CEP170B MISSION shRNA Bacterial Glycerol Stock
centrosomal protein 170B
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172777    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015005.1-5050s1c1
Sequence:CCGGGCCTCCTCTTCATCACTGTTACTCGAGTAACAGTGATGAAGAGGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168618    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015005.1-5092s1c1
Sequence:CCGGGAAAGAGTTGTTGGTGCCATTCTCGAGAATGGCACCAACAACTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172296    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015005.1-923s1c1
Sequence:CCGGCCCTGGCAAGATGAAGATCAACTCGAGTTGATCTTCATCTTGCCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168528    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015005.1-2874s1c1
Sequence:CCGGCTCCTCTCTAATTCTGTGGATCTCGAGATCCACAGAATTAGAGAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168281    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015005.1-2511s1c1
Sequence:CCGGGTGTTATCTAGGAAACCGCTTCTCGAGAAGCGGTTTCCTAGATAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167962    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015005.1-4352s1c1
Sequence:CCGGCGAGAAGATGAAGATCCTCTTCTCGAGAAGAGGATCTTCATCTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015005.1-361s21c1
Sequence:CCGGGCTACGATTCCAACATGTATGCTCGAGCATACATGTTGGAATCGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015005.1-2604s21c1
Sequence:CCGGGTCAGTGCCAATGGGAGAATGCTCGAGCATTCTCCCATTGGCACTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015005
CEP170B MISSION shRNA shRNA Plasmid DNA
centrosomal protein 170B
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172777    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015005.1-5050s1c1
Sequence:CCGGGCCTCCTCTTCATCACTGTTACTCGAGTAACAGTGATGAAGAGGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168618    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015005.1-5092s1c1
Sequence:CCGGGAAAGAGTTGTTGGTGCCATTCTCGAGAATGGCACCAACAACTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172296    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015005.1-923s1c1
Sequence:CCGGCCCTGGCAAGATGAAGATCAACTCGAGTTGATCTTCATCTTGCCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168528    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015005.1-2874s1c1
Sequence:CCGGCTCCTCTCTAATTCTGTGGATCTCGAGATCCACAGAATTAGAGAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168281    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015005.1-2511s1c1
Sequence:CCGGGTGTTATCTAGGAAACCGCTTCTCGAGAAGCGGTTTCCTAGATAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167962    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015005.1-4352s1c1
Sequence:CCGGCGAGAAGATGAAGATCCTCTTCTCGAGAAGAGGATCTTCATCTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015005.1-361s21c1
Sequence:CCGGGCTACGATTCCAACATGTATGCTCGAGCATACATGTTGGAATCGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015005.1-2604s21c1
Sequence:CCGGGTCAGTGCCAATGGGAGAATGCTCGAGCATTCTCCCATTGGCACTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015005
CEP170B MISSION shRNA Lentiviral Transduction Particles
centrosomal protein 170B
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172777    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015005.1-5050s1c1
Sequence:CCGGGCCTCCTCTTCATCACTGTTACTCGAGTAACAGTGATGAAGAGGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168618    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015005.1-5092s1c1
Sequence:CCGGGAAAGAGTTGTTGGTGCCATTCTCGAGAATGGCACCAACAACTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172296    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015005.1-923s1c1
Sequence:CCGGCCCTGGCAAGATGAAGATCAACTCGAGTTGATCTTCATCTTGCCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168528    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015005.1-2874s1c1
Sequence:CCGGCTCCTCTCTAATTCTGTGGATCTCGAGATCCACAGAATTAGAGAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168281    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015005.1-2511s1c1
Sequence:CCGGGTGTTATCTAGGAAACCGCTTCTCGAGAAGCGGTTTCCTAGATAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167962    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015005.1-4352s1c1
Sequence:CCGGCGAGAAGATGAAGATCCTCTTCTCGAGAAGAGGATCTTCATCTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015005.1-361s21c1
Sequence:CCGGGCTACGATTCCAACATGTATGCTCGAGCATACATGTTGGAATCGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015005.1-2604s21c1
Sequence:CCGGGTCAGTGCCAATGGGAGAATGCTCGAGCATTCTCCCATTGGCACTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks