EMAIL THIS PAGE TO A FRIEND

CEP192

centrosomal protein 192kDa

69 Gene Product Result for
Synonyms: PPP1R62
UniProtKB ID: Q8TEP8, Q8WYT8, Q9H0F4, Q9NW27
Gene ID:
Mouse(70799) centrosomal protein 192
Rat(100911755) centrosomal protein 192kDa
sheep(101107490) centrosomal protein 192kDa
domestic guinea pig(101788260) centrosomal protein 192kDa
naked mole-rat(101696517) centrosomal protein 192kDa
chicken(421043) centrosomal protein 192kDa
Horse(100057580) centrosomal protein 192kDa
cow(100335896) centrosomal protein 192kDa
domestic cat(101095689) centrosomal protein 192kDa
dog(480216) centrosomal protein 192kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018069 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018069 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018069 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027556 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027556 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027556 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU026711 MISSION® esiRNA esiRNA targeting human CEP192 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018069 Rosetta Predictions human pricing
NM_032142 Rosetta Predictions human pricing
XM_619551 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018069 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00119186 predicted 1456
2 SASI_Hs01_00119187 predicted 1861
3 SASI_Hs01_00119188 predicted 1685
4 SASI_Hs01_00119189 predicted 1594
5 SASI_Hs01_00119190 predicted 1795
6 SASI_Hs01_00119191 predicted 1953
7 SASI_Hs01_00119192 predicted 1304
8 SASI_Hs01_00119193 predicted 2515
9 SASI_Hs01_00119194 predicted 1811
10 SASI_Hs01_00119195 predicted 2587
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032142 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00173396 predicted 4118
2 SASI_Hs01_00173397 predicted 1856
3 SASI_Hs01_00173398 predicted 4665
4 SASI_Hs01_00173399 predicted 6513
5 SASI_Hs02_00359372 predicted 3452
6 SASI_Hs01_00173400 predicted 4593
7 SASI_Hs01_00173402 predicted 1795
8 SASI_Hs01_00173404 predicted 2508
9 SASI_Hs02_00359373 predicted 1798
10 SASI_Hs01_00173405 predicted 5508
11 SASI_Hs01_00173401 predicted 5860
12 SASI_Hs01_00173403 predicted 4787
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_619551 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00246588 predicted 6202
2 SASI_Mm01_00246589 predicted 6912
3 SASI_Mm01_00246590 predicted 5467
4 SASI_Mm01_00246591 predicted 5555
5 SASI_Mm01_00246592 predicted 7838
6 SASI_Mm01_00246593 predicted 6151
7 SASI_Mm01_00246594 predicted 7262
8 SASI_Mm01_00246595 predicted 6283
9 SASI_Mm01_00246596 predicted 5500
10 SASI_Mm01_00246597 predicted 4582
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018069
VALIDATED
CEP192 MISSION shRNA Bacterial Glycerol Stock
centrosomal protein 192kDa
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000135907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018069.2-2594s1c1
Sequence:CCGGGCGAGTTGAGTACCACAATTACTCGAGTAATTGTGGTACTCAACTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_018069.2-1831s1c1
Sequence:CCGGCCCAAAGAACAAACTACTCAACTCGAGTTGAGTAGTTTGTTCTTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135014    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_018069.2-6736s1c1
Sequence:CCGGCCTGTTACATAAACCAGAGATCTCGAGATCTCTGGTTTATGTAACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_018069.2-1561s1c1
Sequence:CCGGGAGGCATCAGTTAATACTGATCTCGAGATCAGTATTAACTGATGCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_018069.2-1236s1c1
Sequence:CCGGGAGAGAACCTATTGCCTTAATCTCGAGATTAAGGCAATAGGTTCTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018069
VALIDATED
CEP192 MISSION shRNA shRNA Plasmid DNA
centrosomal protein 192kDa
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000135907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018069.2-2594s1c1
Sequence:CCGGGCGAGTTGAGTACCACAATTACTCGAGTAATTGTGGTACTCAACTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_018069.2-1831s1c1
Sequence:CCGGCCCAAAGAACAAACTACTCAACTCGAGTTGAGTAGTTTGTTCTTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135014    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_018069.2-6736s1c1
Sequence:CCGGCCTGTTACATAAACCAGAGATCTCGAGATCTCTGGTTTATGTAACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_018069.2-1561s1c1
Sequence:CCGGGAGGCATCAGTTAATACTGATCTCGAGATCAGTATTAACTGATGCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_018069.2-1236s1c1
Sequence:CCGGGAGAGAACCTATTGCCTTAATCTCGAGATTAAGGCAATAGGTTCTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018069
VALIDATED
CEP192 MISSION shRNA Lentiviral Transduction Particles
centrosomal protein 192kDa
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000135907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018069.2-2594s1c1
Sequence:CCGGGCGAGTTGAGTACCACAATTACTCGAGTAATTGTGGTACTCAACTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_018069.2-1831s1c1
Sequence:CCGGCCCAAAGAACAAACTACTCAACTCGAGTTGAGTAGTTTGTTCTTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135014    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_018069.2-6736s1c1
Sequence:CCGGCCTGTTACATAAACCAGAGATCTCGAGATCTCTGGTTTATGTAACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_018069.2-1561s1c1
Sequence:CCGGGAGGCATCAGTTAATACTGATCTCGAGATCAGTATTAACTGATGCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_018069.2-1236s1c1
Sequence:CCGGGAGAGAACCTATTGCCTTAATCTCGAGATTAAGGCAATAGGTTCTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027556
VALIDATED
CEP192 MISSION shRNA Bacterial Glycerol Stock
centrosomal protein 192kDa
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000346179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027556.1-2087s21c1
Sequence:CCGGGAGAACCTGTTGCGTTAATAACTCGAGTTATTAACGCAACAGGTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346180    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027556.1-7815s21c1
Sequence:CCGGGTGTAAATGACCTGCTTATATCTCGAGATATAAGCAGGTCATTTACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027556.1-2304s21c1
Sequence:CCGGGGACACTCTCTGTAGTAATAACTCGAGTTATTACTACAGAGAGTGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027556.1-1148s21c1
Sequence:CCGGGTGTAGGTACTGTCGATAATACTCGAGTATTATCGACAGTACCTACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027556.1-1897s21c1
Sequence:CCGGGCGACAGTTAATTACCATTTACTCGAGTAAATGGTAATTAACTGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027556
VALIDATED
CEP192 MISSION shRNA shRNA Plasmid DNA
centrosomal protein 192kDa
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000346179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027556.1-2087s21c1
Sequence:CCGGGAGAACCTGTTGCGTTAATAACTCGAGTTATTAACGCAACAGGTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346180    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027556.1-7815s21c1
Sequence:CCGGGTGTAAATGACCTGCTTATATCTCGAGATATAAGCAGGTCATTTACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027556.1-2304s21c1
Sequence:CCGGGGACACTCTCTGTAGTAATAACTCGAGTTATTACTACAGAGAGTGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027556.1-1148s21c1
Sequence:CCGGGTGTAGGTACTGTCGATAATACTCGAGTATTATCGACAGTACCTACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027556.1-1897s21c1
Sequence:CCGGGCGACAGTTAATTACCATTTACTCGAGTAAATGGTAATTAACTGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027556
VALIDATED
CEP192 MISSION shRNA Lentiviral Transduction Particles
centrosomal protein 192kDa
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000346179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027556.1-2087s21c1
Sequence:CCGGGAGAACCTGTTGCGTTAATAACTCGAGTTATTAACGCAACAGGTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346180    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027556.1-7815s21c1
Sequence:CCGGGTGTAAATGACCTGCTTATATCTCGAGATATAAGCAGGTCATTTACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027556.1-2304s21c1
Sequence:CCGGGGACACTCTCTGTAGTAATAACTCGAGTTATTACTACAGAGAGTGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027556.1-1148s21c1
Sequence:CCGGGTGTAGGTACTGTCGATAATACTCGAGTATTATCGACAGTACCTACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027556.1-1897s21c1
Sequence:CCGGGCGACAGTTAATTACCATTTACTCGAGTAAATGGTAATTAACTGTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)