EMAIL THIS PAGE TO A FRIEND

CEP19

centrosomal protein 19kDa

56 Gene Product Result for
Synonyms: C3orf34
UniProtKB ID: Q96LK0, B2RA74, Q96I48
Gene ID:
Mouse(66994) centrosomal protein 19
Rat(192229) centrosomal protein 19
Zebrafish(619252) centrosomal protein 19
chicken(424858) centrosomal protein 19kDa
domestic cat(101082338) centrosomal protein 19kDa
cow(613916) centrosomal protein 19kDa
dog(609577) centrosomal protein 19kDa
naked mole-rat(101711066) centrosomal protein 19kDa
domestic guinea pig(100713692) centrosomal protein 19kDa
sheep(101123256) centrosomal protein 19kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032898 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032898 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032898 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025892 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025892 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025892 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU029441 MISSION® esiRNA esiRNA targeting mouse 1500031L02Rik (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032898 Rosetta Predictions human pricing
NM_138865 Rosetta Predictions rat pricing
NM_025892 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032898 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00141191 predicted 625
2 SASI_Hs01_00141192 predicted 413
3 SASI_Hs02_00360518 predicted 617
4 SASI_Hs01_00141193 predicted 534
5 SASI_Hs01_00141195 predicted 499
6 SASI_Hs01_00141196 predicted 369
7 SASI_Hs01_00141199 predicted 739
8 SASI_Hs01_00141200 predicted 566
9 SASI_Hs02_00360519 predicted 566
10 SASI_Hs02_00360520 predicted 561
11 SASI_Hs01_00141194 predicted 707
12 SASI_Hs01_00141197 predicted 503
13 SASI_Hs01_00141198 predicted 407
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138865 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00042997 predicted 893
2 SASI_Rn01_00042998 predicted 1202
3 SASI_Rn01_00042999 predicted 1234
4 SASI_Rn01_00043000 predicted 990
5 SASI_Rn01_00043001 predicted 1126
6 SASI_Rn01_00043002 predicted 983
7 SASI_Rn02_00268275 predicted 902
8 SASI_Rn01_00043003 predicted 1149
9 SASI_Rn02_00268276 predicted 987
10 SASI_Rn01_00043006 predicted 1209
11 SASI_Rn01_00043004 predicted 366
12 SASI_Rn01_00043005 predicted 913
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025892 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00155866 predicted 499
2 SASI_Mm01_00155867 predicted 1283
3 SASI_Mm01_00155868 predicted 508
4 SASI_Mm01_00155869 predicted 1270
5 SASI_Mm01_00155872 predicted 494
6 SASI_Mm01_00155873 predicted 1370
7 SASI_Mm01_00155874 predicted 1311
8 SASI_Mm01_00155875 predicted 1281
9 SASI_Mm02_00329240 predicted 465
10 SASI_Mm02_00329241 predicted 689
11 SASI_Mm01_00155870 predicted 1366
12 SASI_Mm01_00155871 predicted 1319
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032898
VALIDATED
CEP19 MISSION shRNA Bacterial Glycerol Stock
centrosomal protein 19kDa
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032898.3-531s21c1
Sequence:CCGGCCAGAGCTGCTGAACAATTAACTCGAGTTAATTGTTCAGCAGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_032898.3-806s21c1
Sequence:CCGGTATGACATTGAGGTTGAATTTCTCGAGAAATTCAACCTCAATGTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_032898.3-652s21c1
Sequence:CCGGGGCAGAAACAATGGAACAAATCTCGAGATTTGTTCCATTGTTTCTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032898.3-427s21c1
Sequence:CCGGGTTTCAGCCTCCAGCTATTATCTCGAGATAATAGCTGGAGGCTGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263712    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_032898.3-1957s21c1
Sequence:CCGGTGGGAAATCCACCCATAATAACTCGAGTTATTATGGGTGGATTTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172663    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032898.2-458s1c1
Sequence:CCGGGCGCATTATGCCAGTTCGAAACTCGAGTTTCGAACTGGCATAATGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032898
VALIDATED
CEP19 MISSION shRNA shRNA Plasmid DNA
centrosomal protein 19kDa
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032898.3-531s21c1
Sequence:CCGGCCAGAGCTGCTGAACAATTAACTCGAGTTAATTGTTCAGCAGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_032898.3-806s21c1
Sequence:CCGGTATGACATTGAGGTTGAATTTCTCGAGAAATTCAACCTCAATGTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_032898.3-652s21c1
Sequence:CCGGGGCAGAAACAATGGAACAAATCTCGAGATTTGTTCCATTGTTTCTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032898.3-427s21c1
Sequence:CCGGGTTTCAGCCTCCAGCTATTATCTCGAGATAATAGCTGGAGGCTGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263712    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_032898.3-1957s21c1
Sequence:CCGGTGGGAAATCCACCCATAATAACTCGAGTTATTATGGGTGGATTTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172663    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032898.2-458s1c1
Sequence:CCGGGCGCATTATGCCAGTTCGAAACTCGAGTTTCGAACTGGCATAATGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032898
VALIDATED
CEP19 MISSION shRNA Lentiviral Transduction Particles
centrosomal protein 19kDa
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032898.3-531s21c1
Sequence:CCGGCCAGAGCTGCTGAACAATTAACTCGAGTTAATTGTTCAGCAGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_032898.3-806s21c1
Sequence:CCGGTATGACATTGAGGTTGAATTTCTCGAGAAATTCAACCTCAATGTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_032898.3-652s21c1
Sequence:CCGGGGCAGAAACAATGGAACAAATCTCGAGATTTGTTCCATTGTTTCTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032898.3-427s21c1
Sequence:CCGGGTTTCAGCCTCCAGCTATTATCTCGAGATAATAGCTGGAGGCTGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263712    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_032898.3-1957s21c1
Sequence:CCGGTGGGAAATCCACCCATAATAACTCGAGTTATTATGGGTGGATTTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172663    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032898.2-458s1c1
Sequence:CCGGGCGCATTATGCCAGTTCGAAACTCGAGTTTCGAACTGGCATAATGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025892
VALIDATED
CEP19 MISSION shRNA Bacterial Glycerol Stock
centrosomal protein 19kDa
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000264984    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025892.2-964s21c1
Sequence:CCGGCTGAAACACTAGCGATCTATACTCGAGTATAGATCGCTAGTGTTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025892.2-724s21c1
Sequence:CCGGCCGAGGAAGACCTGAACAAACCTCGAGGTTTGTTCAGGTCTTCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025892.2-516s21c1
Sequence:CCGGCGTATCATGCCTGTCCGAAACCTCGAGGTTTCGGACAGGCATGATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025892.2-561s21c1
Sequence:CCGGAGAGCTGCGGAACAGTTAAAGCTCGAGCTTTAACTGTTCCGCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025892.2-464s21c1
Sequence:CCGGTCCAGCTGTGATCTTGATTTACTCGAGTAAATCAAGATCACAGCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201580    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025892.1-1323s1c1
Sequence:CCGGCCTGTGTTCTTCAGGACTCTACTCGAGTAGAGTCCTGAAGAACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191941    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025892.1-681s1c1
Sequence:CCGGGCAGAAACAATGGAACAGATTCTCGAGAATCTGTTCCATTGTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200630    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025892.1-565s1c1
Sequence:CCGGCTGCGGAACAGTTAAAGAATACTCGAGTATTCTTTAACTGTTCCGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025892
VALIDATED
CEP19 MISSION shRNA shRNA Plasmid DNA
centrosomal protein 19kDa
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000264984    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025892.2-964s21c1
Sequence:CCGGCTGAAACACTAGCGATCTATACTCGAGTATAGATCGCTAGTGTTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025892.2-724s21c1
Sequence:CCGGCCGAGGAAGACCTGAACAAACCTCGAGGTTTGTTCAGGTCTTCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025892.2-516s21c1
Sequence:CCGGCGTATCATGCCTGTCCGAAACCTCGAGGTTTCGGACAGGCATGATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025892.2-561s21c1
Sequence:CCGGAGAGCTGCGGAACAGTTAAAGCTCGAGCTTTAACTGTTCCGCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025892.2-464s21c1
Sequence:CCGGTCCAGCTGTGATCTTGATTTACTCGAGTAAATCAAGATCACAGCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201580    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025892.1-1323s1c1
Sequence:CCGGCCTGTGTTCTTCAGGACTCTACTCGAGTAGAGTCCTGAAGAACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191941    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025892.1-681s1c1
Sequence:CCGGGCAGAAACAATGGAACAGATTCTCGAGAATCTGTTCCATTGTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200630    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025892.1-565s1c1
Sequence:CCGGCTGCGGAACAGTTAAAGAATACTCGAGTATTCTTTAACTGTTCCGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025892
VALIDATED
CEP19 MISSION shRNA Lentiviral Transduction Particles
centrosomal protein 19kDa
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000264984    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025892.2-964s21c1
Sequence:CCGGCTGAAACACTAGCGATCTATACTCGAGTATAGATCGCTAGTGTTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025892.2-724s21c1
Sequence:CCGGCCGAGGAAGACCTGAACAAACCTCGAGGTTTGTTCAGGTCTTCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025892.2-516s21c1
Sequence:CCGGCGTATCATGCCTGTCCGAAACCTCGAGGTTTCGGACAGGCATGATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025892.2-561s21c1
Sequence:CCGGAGAGCTGCGGAACAGTTAAAGCTCGAGCTTTAACTGTTCCGCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025892.2-464s21c1
Sequence:CCGGTCCAGCTGTGATCTTGATTTACTCGAGTAAATCAAGATCACAGCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201580    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025892.1-1323s1c1
Sequence:CCGGCCTGTGTTCTTCAGGACTCTACTCGAGTAGAGTCCTGAAGAACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191941    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025892.1-681s1c1
Sequence:CCGGGCAGAAACAATGGAACAGATTCTCGAGAATCTGTTCCATTGTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200630    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025892.1-565s1c1
Sequence:CCGGCTGCGGAACAGTTAAAGAATACTCGAGTATTCTTTAACTGTTCCGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks