EMAIL THIS PAGE TO A FRIEND

CEP250

centrosomal protein 250kDa

99 Gene Product Result for
Synonyms: C-NAP1 CEP2 CNAP1
UniProtKB ID: Q9BV73, E1P5Q3, O14812, O60588, Q9H450
Gene ID:
Human(11190) Summary: This gene encodes a core centrosomal protein required for centriole-centriole cohesion during interphase of the cell cycle. The encoded protein dissociates from the centrosomes when parental centrioles separate at the beginning of mitosis. The protein associates with and is phosphorylated by NIMA-related kinase 2, which is also associated with the centrosome. [provided by RefSeq, Jun 2009]
Mouse(16328) centrosomal protein 250
Rat(311573) centrosomal protein 250
chicken(419138) centrosomal protein 250kDa
cow(507479) centrosomal protein 250kDa
Horse(100069526) centrosomal protein 250kDa
domestic cat(101081284) centrosomal protein 250kDa
dog(485851) centrosomal protein 250kDa
naked mole-rat(101696606) centrosomal protein 250kDa
domestic guinea pig(100732930) centrosomal protein 250kDa
sheep(101120102) centrosomal protein 250kDa
Domestic Rabbit(100355443) centrosomal protein 250kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001129999 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001129999 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001129999 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007186 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007186 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007186 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001035518 Rosetta Predictions human pricing
NM_007186 Rosetta Predictions human pricing
XM_230784 Rosetta Predictions rat pricing
XR_009560 Rosetta Predictions rat pricing
NM_001129999 Rosetta Predictions mouse pricing
NM_001130000 Rosetta Predictions mouse pricing
NM_008383 Rosetta Predictions mouse pricing
NM_177217 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001035518 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00195213 predicted 5495
2 SASI_Hs01_00195214 predicted 2272
3 SASI_Hs02_00308202 predicted 5715
4 SASI_Hs01_00195215 predicted 1202
5 SASI_Hs01_00195216 predicted 2750
6 SASI_Hs01_00195217 predicted 4942
7 SASI_Hs01_00195218 predicted 2433
8 SASI_Hs01_00195219 predicted 1649
9 SASI_Hs01_00195220 predicted 1778
10 SASI_Hs01_00195221 predicted 6899
11 SASI_Hs01_00195222 predicted 1909
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007186 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00152553 predicted 5661
2 SASI_Hs01_00152554 predicted 2278
3 SASI_Hs02_00343152 predicted 5879
4 SASI_Hs01_00152555 predicted 1199
5 SASI_Hs01_00152556 predicted 2751
6 SASI_Hs01_00152557 predicted 5112
7 SASI_Hs01_00152558 predicted 2433
8 SASI_Hs01_00152559 predicted 1647
9 SASI_Hs01_00152560 predicted 1774
10 SASI_Hs01_00152561 predicted 7067
11 SASI_Hs01_00152562 predicted 1905
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_230784 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00386442 predicted 3785
2 SASI_Rn02_00386443 predicted 5395
3 SASI_Rn02_00386444 predicted 4929
4 SASI_Rn02_00386445 predicted 5689
5 SASI_Rn02_00386446 predicted 5103
6 SASI_Rn02_00386447 predicted 5129
7 SASI_Rn02_00386448 predicted 5682
8 SASI_Rn02_00386449 predicted 5213
9 SASI_Rn02_00386450 predicted 5577
10 SASI_Rn02_00386451 predicted 5214
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_009560 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00420141 predicted 5202
2 SASI_Rn01_00156576 predicted 2942
3 SASI_Rn01_00156577 predicted 7693
4 SASI_Rn02_00420142 predicted 5296
5 SASI_Rn01_00156578 predicted 3512
6 SASI_Rn01_00156579 predicted 1296
7 SASI_Rn01_00156580 predicted 2601
8 SASI_Rn01_00156581 predicted 342
9 SASI_Rn02_00420143 predicted 7182
10 SASI_Rn02_00420144 predicted 5218
11 SASI_Rn01_00156572 predicted 2515
12 SASI_Rn01_00156573 predicted 7684
13 SASI_Rn01_00156574 predicted 989
14 SASI_Rn01_00156575 predicted 1325
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001129999 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00310808 predicted 3012
2 SASI_Mm02_00310809 predicted 3587
3 SASI_Mm02_00310810 predicted 2458
4 SASI_Mm02_00310811 predicted 2573
5 SASI_Mm02_00310812 predicted 5279
6 SASI_Mm02_00310813 predicted 6500
7 SASI_Mm02_00310814 predicted 5374
8 SASI_Mm02_00310815 predicted 5297
9 SASI_Mm02_00310816 predicted 349
10 SASI_Mm02_00310817 predicted 6763
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130000 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00310818 predicted 3008
2 SASI_Mm02_00310819 predicted 3582
3 SASI_Mm02_00310820 predicted 2461
4 SASI_Mm02_00310821 predicted 2572
5 SASI_Mm02_00310822 predicted 5278
6 SASI_Mm02_00310823 predicted 6497
7 SASI_Mm02_00310824 predicted 5365
8 SASI_Mm02_00310825 predicted 5288
9 SASI_Mm02_00310826 predicted 349
10 SASI_Mm02_00310827 predicted 6763
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008383 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00144640 predicted 3526
2 SASI_Mm01_00144642 predicted 2402
3 SASI_Mm01_00144643 predicted 2512
4 SASI_Mm01_00144644 predicted 5212
5 SASI_Mm01_00144645 predicted 6438
6 SASI_Mm01_00144646 predicted 5309
7 SASI_Mm01_00144647 predicted 5230
8 SASI_Mm02_00313757 predicted 355
9 SASI_Mm02_00313758 predicted 6706
10 SASI_Mm02_00313759 predicted 5242
11 SASI_Mm01_00144639 predicted 2753
12 SASI_Mm01_00144641 predicted 792
13 SASI_Mm01_00144648 predicted 1243
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177217 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00347241 predicted 2944
2 SASI_Mm02_00347242 predicted 3520
3 SASI_Mm02_00347243 predicted 2401
4 SASI_Mm02_00347244 predicted 2513
5 SASI_Mm02_00347245 predicted 5207
6 SASI_Mm02_00347246 predicted 6435
7 SASI_Mm02_00347247 predicted 5305
8 SASI_Mm02_00347248 predicted 5230
9 SASI_Mm02_00347249 predicted 341
10 SASI_Mm02_00347250 predicted 6700
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001129999
CEP250 MISSION shRNA Bacterial Glycerol Stock
centrosomal protein 250kDa
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000258228    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001129999.1-7610s21c1
Sequence:CCGGAGTTTGCCAAAGGCGAGATTTCTCGAGAAATCTCGCCTTTGGCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129999.1-692s21c1
Sequence:CCGGGAGTTCTTCAAGGGCTATTTGCTCGAGCAAATAGCCCTTGAAGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129999.1-2570s21c1
Sequence:CCGGCAACTGGAGAGCAATCTATTTCTCGAGAAATAGATTGCTCTCCAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129999.1-5375s21c1
Sequence:CCGGGATGGAAAGAGCCCGAGTAAACTCGAGTTTACTCGGGCTCTTTCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129999.1-724s21c1
Sequence:CCGGCGGTCGTCTTCTCAATCTATGCTCGAGCATAGATTGAGAAGACGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001129999
CEP250 MISSION shRNA shRNA Plasmid DNA
centrosomal protein 250kDa
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000258228    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001129999.1-7610s21c1
Sequence:CCGGAGTTTGCCAAAGGCGAGATTTCTCGAGAAATCTCGCCTTTGGCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129999.1-692s21c1
Sequence:CCGGGAGTTCTTCAAGGGCTATTTGCTCGAGCAAATAGCCCTTGAAGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129999.1-2570s21c1
Sequence:CCGGCAACTGGAGAGCAATCTATTTCTCGAGAAATAGATTGCTCTCCAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129999.1-5375s21c1
Sequence:CCGGGATGGAAAGAGCCCGAGTAAACTCGAGTTTACTCGGGCTCTTTCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129999.1-724s21c1
Sequence:CCGGCGGTCGTCTTCTCAATCTATGCTCGAGCATAGATTGAGAAGACGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001129999
CEP250 MISSION shRNA Lentiviral Transduction Particles
centrosomal protein 250kDa
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000258228    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001129999.1-7610s21c1
Sequence:CCGGAGTTTGCCAAAGGCGAGATTTCTCGAGAAATCTCGCCTTTGGCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129999.1-692s21c1
Sequence:CCGGGAGTTCTTCAAGGGCTATTTGCTCGAGCAAATAGCCCTTGAAGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129999.1-2570s21c1
Sequence:CCGGCAACTGGAGAGCAATCTATTTCTCGAGAAATAGATTGCTCTCCAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129999.1-5375s21c1
Sequence:CCGGGATGGAAAGAGCCCGAGTAAACTCGAGTTTACTCGGGCTCTTTCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129999.1-724s21c1
Sequence:CCGGCGGTCGTCTTCTCAATCTATGCTCGAGCATAGATTGAGAAGACGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007186
CEP250 MISSION shRNA Bacterial Glycerol Stock
centrosomal protein 250kDa
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007186.2-3891s1c1
Sequence:CCGGGCTGACTCTATTCGACAACAACTCGAGTTGTTGTCGAATAGAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007186.2-1706s1c1
Sequence:CCGGCAAGGATATAACCCAGGTCATCTCGAGATGACCTGGGTTATATCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007186.2-7068s1c1
Sequence:CCGGCCAATGGAGGAACAATCTCTACTCGAGTAGAGATTGTTCCTCCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007186.2-3527s1c1
Sequence:CCGGGCAGGACATGAAAGTCCAGAACTCGAGTTCTGGACTTTCATGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007186.2-7921s1c1
Sequence:CCGGCCCTGACTCAAAGTCTGACATCTCGAGATGTCAGACTTTGAGTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007186
CEP250 MISSION shRNA shRNA Plasmid DNA
centrosomal protein 250kDa
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007186.2-3891s1c1
Sequence:CCGGGCTGACTCTATTCGACAACAACTCGAGTTGTTGTCGAATAGAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007186.2-1706s1c1
Sequence:CCGGCAAGGATATAACCCAGGTCATCTCGAGATGACCTGGGTTATATCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007186.2-7068s1c1
Sequence:CCGGCCAATGGAGGAACAATCTCTACTCGAGTAGAGATTGTTCCTCCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007186.2-3527s1c1
Sequence:CCGGGCAGGACATGAAAGTCCAGAACTCGAGTTCTGGACTTTCATGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007186.2-7921s1c1
Sequence:CCGGCCCTGACTCAAAGTCTGACATCTCGAGATGTCAGACTTTGAGTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007186
CEP250 MISSION shRNA Lentiviral Transduction Particles
centrosomal protein 250kDa
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007186.2-3891s1c1
Sequence:CCGGGCTGACTCTATTCGACAACAACTCGAGTTGTTGTCGAATAGAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007186.2-1706s1c1
Sequence:CCGGCAAGGATATAACCCAGGTCATCTCGAGATGACCTGGGTTATATCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007186.2-7068s1c1
Sequence:CCGGCCAATGGAGGAACAATCTCTACTCGAGTAGAGATTGTTCCTCCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007186.2-3527s1c1
Sequence:CCGGGCAGGACATGAAAGTCCAGAACTCGAGTTCTGGACTTTCATGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007186.2-7921s1c1
Sequence:CCGGCCCTGACTCAAAGTCTGACATCTCGAGATGTCAGACTTTGAGTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks