EMAIL THIS PAGE TO A FRIEND

CEP290

centrosomal protein 290kDa

59 Gene Product Result for
Synonyms: 3H11Ag BBS14 CT87 JBTS5 LCA10 MKS4 NPHP6 POC3 SLSN6 rd16
UniProtKB ID: O15078, Q1PSK5, Q66GS8, Q9H2G6, Q9H6Q7, Q9H8I0
Gene ID:
Human(80184) Summary: This gene encodes a protein with 13 putative coiled-coil domains, a region with homology to SMC chromosome segregation ATPases, six KID motifs, three tropomyosin homology domains and an ATP/GTP binding site motif A. The protein is localized to the centrosome and cilia and has sites for N-glycosylation, tyrosine sulfation, phosphorylation, N-myristoylation, and amidation. Mutations in this gene have been associated with Joubert syndrome and nephronophthisis and the presence of antibodies against this protein is associated with several forms of cancer. [provided by RefSeq, Jul 2008]
Mouse(216274) centrosomal protein 290
Rat(314787) centrosomal protein 290
domestic guinea pig(100723393) centrosomal protein 290kDa
naked mole-rat(101726504) centrosomal protein 290kDa
sheep(101109526) centrosomal protein 290kDa
Zebrafish(560588) centrosomal protein 290
cow(282707) centrosomal protein 290kDa
Horse(100051209) centrosomal protein 290kDa
domestic cat(100113471) centrosomal protein 290kDa
dog(482591) centrosomal protein 290kDa
chicken(417887) centrosomal protein 290kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025114 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025114 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025114 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU103941 MISSION® esiRNA esiRNA human CEP290 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025114 Rosetta Predictions human pricing
XM_001080641 Rosetta Predictions rat pricing
XM_235095 Rosetta Predictions rat pricing
NM_146009 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025114 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00096034 predicted 4085
2 SASI_Hs01_00096035 predicted 7459
3 SASI_Hs01_00096036 predicted 6241
4 SASI_Hs01_00096037 predicted 4036
5 SASI_Hs01_00096040 predicted 3996
6 SASI_Hs01_00096041 predicted 2270
7 SASI_Hs01_00096042 predicted 2409
8 SASI_Hs02_00357813 predicted 4542
9 SASI_Hs01_00096043 predicted 2646
10 SASI_Hs02_00357814 predicted 3256
11 SASI_Hs01_00096038 predicted 5676
12 SASI_Hs01_00096039 predicted 1205
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080641 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00368780 predicted 7252
2 SASI_Rn02_00368781 predicted 1587
3 SASI_Rn02_00368782 predicted 251
4 SASI_Rn02_00368783 predicted 2377
5 SASI_Rn02_00368784 predicted 1948
6 SASI_Rn02_00368785 predicted 1840
7 SASI_Rn02_00368786 predicted 847
8 SASI_Rn02_00368787 predicted 7314
9 SASI_Rn02_00368788 predicted 3608
10 SASI_Rn02_00368789 predicted 3807
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_235095 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00388985 predicted 7257
2 SASI_Rn02_00388986 predicted 1587
3 SASI_Rn02_00388987 predicted 2379
4 SASI_Rn02_00388988 predicted 1940
5 SASI_Rn02_00388989 predicted 1837
6 SASI_Rn02_00388990 predicted 841
7 SASI_Rn02_00388991 predicted 7316
8 SASI_Rn02_00388992 predicted 3608
9 SASI_Rn02_00388993 predicted 3875
10 SASI_Rn02_00388994 predicted 3801
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146009 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00341551 predicted 446
2 SASI_Mm02_00341552 predicted 5082
3 SASI_Mm02_00341553 predicted 4648
4 SASI_Mm02_00341554 predicted 645
5 SASI_Mm02_00341555 predicted 1985
6 SASI_Mm02_00341556 predicted 4100
7 SASI_Mm02_00341557 predicted 4601
8 SASI_Mm02_00341558 predicted 5185
9 SASI_Mm02_00341559 predicted 7137
10 SASI_Mm02_00341560 predicted 1334
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025114
VALIDATED
CEP290 MISSION shRNA Bacterial Glycerol Stock
centrosomal protein 290kDa
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025114.1-1245s1c1
Sequence:CCGGCCAATTATGGTAGCTGTCAATCTCGAGATTGACAGCTACCATAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_025114.1-1983s1c1
Sequence:CCGGGAAGAACGACTTGATCTGAAACTCGAGTTTCAGATCAAGTCGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145008    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025114.1-1203s1c1
Sequence:CCGGGAGCTTACAGATCTTCTGAAACTCGAGTTTCAGAAGATCTGTAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_025114.1-1431s1c1
Sequence:CCGGCAAATTAAGATGCTCACCGAACTCGAGTTCGGTGAGCATCTTAATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145392    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025114.1-1719s1c1
Sequence:CCGGGAAGATGCTGTCGTTGAAATACTCGAGTATTTCAACGACAGCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_025114.1-543s1c1
Sequence:CCGGGAGCTGGCTTTGGAAGAAGTACTCGAGTACTTCTTCCAAAGCCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_025114.1-947s1c1
Sequence:CCGGCAGTGACTACCGATCACAGTTCTCGAGAACTGTGATCGGTAGTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141320    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025114.1-402s1c1
Sequence:CCGGCGTCAAGAAGAACTGGCAGATCTCGAGATCTGCCAGTTCTTCTTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025114.3-1983s21c1
Sequence:CCGGGAAGAACGACTTGATCTGAAACTCGAGTTTCAGATCAAGTCGTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025114.3-3225s21c1
Sequence:CCGGGAACTAGAACTGGCTAATAAACTCGAGTTTATTAGCCAGTTCTAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025114.3-543s21c1
Sequence:CCGGGAGCTGGCTTTGGAAGAAGTACTCGAGTACTTCTTCCAAAGCCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025114.3-2507s21c1
Sequence:CCGGATCTCGGAAAGAGGCTATAAACTCGAGTTTATAGCCTCTTTCCGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025114.3-947s21c1
Sequence:CCGGCAGTGACTACCGATCACAGTTCTCGAGAACTGTGATCGGTAGTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025114
VALIDATED
CEP290 MISSION shRNA shRNA Plasmid DNA
centrosomal protein 290kDa
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025114.1-1245s1c1
Sequence:CCGGCCAATTATGGTAGCTGTCAATCTCGAGATTGACAGCTACCATAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_025114.1-1983s1c1
Sequence:CCGGGAAGAACGACTTGATCTGAAACTCGAGTTTCAGATCAAGTCGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145008    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025114.1-1203s1c1
Sequence:CCGGGAGCTTACAGATCTTCTGAAACTCGAGTTTCAGAAGATCTGTAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_025114.1-1431s1c1
Sequence:CCGGCAAATTAAGATGCTCACCGAACTCGAGTTCGGTGAGCATCTTAATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145392    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025114.1-1719s1c1
Sequence:CCGGGAAGATGCTGTCGTTGAAATACTCGAGTATTTCAACGACAGCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_025114.1-543s1c1
Sequence:CCGGGAGCTGGCTTTGGAAGAAGTACTCGAGTACTTCTTCCAAAGCCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_025114.1-947s1c1
Sequence:CCGGCAGTGACTACCGATCACAGTTCTCGAGAACTGTGATCGGTAGTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141320    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025114.1-402s1c1
Sequence:CCGGCGTCAAGAAGAACTGGCAGATCTCGAGATCTGCCAGTTCTTCTTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025114.3-1983s21c1
Sequence:CCGGGAAGAACGACTTGATCTGAAACTCGAGTTTCAGATCAAGTCGTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025114.3-3225s21c1
Sequence:CCGGGAACTAGAACTGGCTAATAAACTCGAGTTTATTAGCCAGTTCTAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025114.3-543s21c1
Sequence:CCGGGAGCTGGCTTTGGAAGAAGTACTCGAGTACTTCTTCCAAAGCCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025114.3-2507s21c1
Sequence:CCGGATCTCGGAAAGAGGCTATAAACTCGAGTTTATAGCCTCTTTCCGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025114.3-947s21c1
Sequence:CCGGCAGTGACTACCGATCACAGTTCTCGAGAACTGTGATCGGTAGTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025114
VALIDATED
CEP290 MISSION shRNA Lentiviral Transduction Particles
centrosomal protein 290kDa
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025114.1-1245s1c1
Sequence:CCGGCCAATTATGGTAGCTGTCAATCTCGAGATTGACAGCTACCATAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_025114.1-1983s1c1
Sequence:CCGGGAAGAACGACTTGATCTGAAACTCGAGTTTCAGATCAAGTCGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145008    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025114.1-1203s1c1
Sequence:CCGGGAGCTTACAGATCTTCTGAAACTCGAGTTTCAGAAGATCTGTAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_025114.1-1431s1c1
Sequence:CCGGCAAATTAAGATGCTCACCGAACTCGAGTTCGGTGAGCATCTTAATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145392    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025114.1-1719s1c1
Sequence:CCGGGAAGATGCTGTCGTTGAAATACTCGAGTATTTCAACGACAGCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_025114.1-543s1c1
Sequence:CCGGGAGCTGGCTTTGGAAGAAGTACTCGAGTACTTCTTCCAAAGCCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_025114.1-947s1c1
Sequence:CCGGCAGTGACTACCGATCACAGTTCTCGAGAACTGTGATCGGTAGTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141320    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025114.1-402s1c1
Sequence:CCGGCGTCAAGAAGAACTGGCAGATCTCGAGATCTGCCAGTTCTTCTTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025114.3-1983s21c1
Sequence:CCGGGAAGAACGACTTGATCTGAAACTCGAGTTTCAGATCAAGTCGTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025114.3-3225s21c1
Sequence:CCGGGAACTAGAACTGGCTAATAAACTCGAGTTTATTAGCCAGTTCTAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025114.3-543s21c1
Sequence:CCGGGAGCTGGCTTTGGAAGAAGTACTCGAGTACTTCTTCCAAAGCCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025114.3-2507s21c1
Sequence:CCGGATCTCGGAAAGAGGCTATAAACTCGAGTTTATAGCCTCTTTCCGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025114.3-947s21c1
Sequence:CCGGCAGTGACTACCGATCACAGTTCTCGAGAACTGTGATCGGTAGTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks