EMAIL THIS PAGE TO A FRIEND

CEP350

centrosomal protein 350kDa

312 Gene Product Result for
Synonyms: CAP350 GM133
UniProtKB ID: Q5VT06, O75068, Q8TDK3, Q8WY20
Gene ID:
Human(9857) Summary: The product of this gene is a large protein with a CAP-Gly domain typically found in cytoskeleton-associated proteins. The encoded protein primarily localizes to the centrosome, a non-membraneous organelle that functions as the major microtubule-organizing center in animal cells. The encoded protein directly interacts with another large centrosomal protein and is required to anchor microtubules at the centrosome. It is also implicated in the regulation of a class of nuclear hormone receptors in the nucleus. Several alternatively spliced transcript variants have been found, but their full-length nature has not been determined. [provided by RefSeq, Jul 2008]
Mouse(74081) centrosomal protein 350
Rat(246304) centrosomal protein 350
chicken(424417) centrosomal protein 350kDa
dog(480028) centrosomal protein 350kDa
Horse(100051014) centrosomal protein 350kDa
cow(534896) centrosomal protein 350kDa
domestic cat(101095544) centrosomal protein 350kDa
sheep(101122613) centrosomal protein 350kDa
Domestic Rabbit(100349670) centrosomal protein 350kDa
naked mole-rat(101724796) centrosomal protein 350kDa
domestic guinea pig(100730106) centrosomal protein 350kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001039184 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001039184 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001039184 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014810 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014810 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014810 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014810 Rosetta Predictions human pricing
XM_001067472 Rosetta Predictions rat pricing
XM_341136 Rosetta Predictions rat pricing
XM_129509 Rosetta Predictions mouse pricing
XM_900343 Rosetta Predictions mouse pricing
XM_900345 Rosetta Predictions mouse pricing
XM_900349 Rosetta Predictions mouse pricing
XM_916986 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014810 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00346331 predicted 2788
2 SASI_Hs02_00346332 predicted 4300
3 SASI_Hs02_00346333 predicted 7803
4 SASI_Hs02_00346334 predicted 7277
5 SASI_Hs01_00028911 predicted 2665
6 SASI_Hs01_00028912 predicted 7321
7 SASI_Hs01_00028913 predicted 2831
8 SASI_Hs01_00028914 predicted 6829
9 SASI_Hs02_00346335 predicted 9468
10 SASI_Hs02_00346336 predicted 3173
11 SASI_Hs01_00028908 predicted 413
12 SASI_Hs01_00028909 predicted 4545
13 SASI_Hs01_00028910 predicted 9055
14 SASI_Hs01_00028915 predicted 7926
15 SASI_Hs01_00028916 predicted 4397
16 SASI_Hs01_00028917 predicted 7630
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067472 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00321087 predicted 578
2 SASI_Rn02_00321088 predicted 6170
3 SASI_Rn02_00321089 predicted 7011
4 SASI_Rn02_00321090 predicted 9047
5 SASI_Rn02_00321091 predicted 8559
6 SASI_Rn02_00321092 predicted 2827
7 SASI_Rn02_00321093 predicted 728
8 SASI_Rn02_00321094 predicted 2730
9 SASI_Rn02_00321095 predicted 567
10 SASI_Rn02_00321096 predicted 4950
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341136 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00392443 predicted 6137
2 SASI_Rn02_00392444 predicted 8956
3 SASI_Rn02_00392445 predicted 2902
4 SASI_Rn02_00392446 predicted 8464
5 SASI_Rn02_00392447 predicted 2831
6 SASI_Rn02_00392448 predicted 4216
7 SASI_Rn02_00392449 predicted 2731
8 SASI_Rn02_00392450 predicted 4925
9 SASI_Rn02_00392451 predicted 3609
10 SASI_Rn02_00392452 predicted 9078
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_129509 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00255490 predicted 1328
2 SASI_Mm01_00255491 predicted 1123
3 SASI_Mm01_00255492 predicted 1480
4 SASI_Mm01_00255493 predicted 1271
5 SASI_Mm01_00255494 predicted 1490
6 SASI_Mm01_00255495 predicted 1422
7 SASI_Mm01_00255496 predicted 1363
8 SASI_Mm01_00255497 predicted 1513
9 SASI_Mm01_00255498 predicted 1188
10 SASI_Mm01_00255499 predicted 1360
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900343 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00238877 predicted 937
2 SASI_Mm01_00238878 predicted 522
3 SASI_Mm01_00238879 predicted 713
4 SASI_Mm01_00238880 predicted 1082
5 SASI_Mm01_00238881 predicted 925
6 SASI_Mm01_00238882 predicted 398
7 SASI_Mm01_00238883 predicted 968
8 SASI_Mm01_00238884 predicted 738
9 SASI_Mm01_00238885 predicted 874
10 SASI_Mm01_00238886 predicted 460
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900345 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00216006 predicted 1057
2 SASI_Mm01_00216007 predicted 638
3 SASI_Mm01_00216008 predicted 837
4 SASI_Mm01_00216009 predicted 1193
5 SASI_Mm01_00216010 predicted 1047
6 SASI_Mm01_00216011 predicted 521
7 SASI_Mm01_00216012 predicted 1093
8 SASI_Mm01_00216013 predicted 856
9 SASI_Mm01_00216014 predicted 988
10 SASI_Mm01_00216015 predicted 585
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900349 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00212074 predicted 869
2 SASI_Mm01_00212075 predicted 939
3 SASI_Mm01_00212076 predicted 814
4 SASI_Mm01_00212077 predicted 968
5 SASI_Mm01_00212078 predicted 933
6 SASI_Mm01_00212079 predicted 915
7 SASI_Mm01_00212080 predicted 838
8 SASI_Mm01_00212081 predicted 713
9 SASI_Mm01_00212082 predicted 985
10 SASI_Mm01_00212083 predicted 801
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_916986 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00440751 predicted 3194
2 SASI_Mm02_00440752 predicted 8127
3 SASI_Mm02_00440753 predicted 9642
4 SASI_Mm02_00440754 predicted 2842
5 SASI_Mm02_00440755 predicted 2912
6 SASI_Mm02_00440756 predicted 828
7 SASI_Mm02_00440757 predicted 8923
8 SASI_Mm02_00440758 predicted 4619
9 SASI_Mm02_00440759 predicted 4985
10 SASI_Mm02_00440760 predicted 2861
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039184
CEP350 MISSION shRNA Bacterial Glycerol Stock
centrosomal protein 350kDa
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000346184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039184.1-915s21c1
Sequence:CCGGTAGTCGGGAAGACCGGAATATCTCGAGATATTCCGGTCTTCCCGACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039184.1-8134s21c1
Sequence:CCGGGAACAGTACCAACCCTATAATCTCGAGATTATAGGGTTGGTACTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039184.1-4491s21c1
Sequence:CCGGATCTCTGGCTCAGATCATAAACTCGAGTTTATGATCTGAGCCAGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039184.1-2844s21c1
Sequence:CCGGACCTAGTACCAGCCAATATAACTCGAGTTATATTGGCTGGTACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346126    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039184.1-9856s21c1
Sequence:CCGGATGTGGTATATCTGGTATTACCTCGAGGTAATACCAGATATACCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039184
CEP350 MISSION shRNA shRNA Plasmid DNA
centrosomal protein 350kDa
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000346184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039184.1-915s21c1
Sequence:CCGGTAGTCGGGAAGACCGGAATATCTCGAGATATTCCGGTCTTCCCGACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039184.1-8134s21c1
Sequence:CCGGGAACAGTACCAACCCTATAATCTCGAGATTATAGGGTTGGTACTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039184.1-4491s21c1
Sequence:CCGGATCTCTGGCTCAGATCATAAACTCGAGTTTATGATCTGAGCCAGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039184.1-2844s21c1
Sequence:CCGGACCTAGTACCAGCCAATATAACTCGAGTTATATTGGCTGGTACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346126    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039184.1-9856s21c1
Sequence:CCGGATGTGGTATATCTGGTATTACCTCGAGGTAATACCAGATATACCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039184
CEP350 MISSION shRNA Lentiviral Transduction Particles
centrosomal protein 350kDa
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000346184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039184.1-915s21c1
Sequence:CCGGTAGTCGGGAAGACCGGAATATCTCGAGATATTCCGGTCTTCCCGACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039184.1-8134s21c1
Sequence:CCGGGAACAGTACCAACCCTATAATCTCGAGATTATAGGGTTGGTACTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039184.1-4491s21c1
Sequence:CCGGATCTCTGGCTCAGATCATAAACTCGAGTTTATGATCTGAGCCAGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039184.1-2844s21c1
Sequence:CCGGACCTAGTACCAGCCAATATAACTCGAGTTATATTGGCTGGTACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346126    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039184.1-9856s21c1
Sequence:CCGGATGTGGTATATCTGGTATTACCTCGAGGTAATACCAGATATACCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014810
VALIDATED
CEP350 MISSION shRNA Bacterial Glycerol Stock
centrosomal protein 350kDa
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000330114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014810.4-4233s21c1
Sequence:CCGGCCTCCAACTATAACAGGATTTCTCGAGAAATCCTGTTATAGTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014810.4-891s21c1
Sequence:CCGGAGTCGAGAAGAACGGAATATACTCGAGTATATTCCGTTCTTCTCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330041    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014810.4-9928s21c1
Sequence:CCGGCACTGGATTAATGGGTTATTTCTCGAGAAATAACCCATTAATCCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014810.4-8139s21c1
Sequence:CCGGGAACGATATCAGTGCTATAATCTCGAGATTATAGCACTGATATCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014810.4-2819s21c1
Sequence:CCGGACCTAGTGCCAGCCAATATAACTCGAGTTATATTGGCTGGCACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130933    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014810.2-9339s1c1
Sequence:CCGGCGAGTGGATCATATCCTGGTTCTCGAGAACCAGGATATGATCCACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014810.2-4017s1c1
Sequence:CCGGCCTCCAACTATAACAGGATTTCTCGAGAAATCCTGTTATAGTTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128781    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014810.2-10270s1c1
Sequence:CCGGCCTGCACTTGTCTTACTCATTCTCGAGAATGAGTAAGACAAGTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014810.2-8594s1c1
Sequence:CCGGGCCAAGTATTTCAGGTTGCTTCTCGAGAAGCAACCTGAAATACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150047    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014810.2-11054s1c1
Sequence:CCGGCCTGGAATGTTATAGCTTCAACTCGAGTTGAAGCTATAACATTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149439    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014810.2-2863s1c1
Sequence:CCGGGCTGTGTATCTCATGCAACTTCTCGAGAAGTTGCATGAGATACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014810.2-1097s1c1
Sequence:CCGGCCATCCAGTAATGGTTGTTAACTCGAGTTAACAACCATTACTGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014810.2-2610s1c1
Sequence:CCGGGCCAGCCAATATAAGAGTAAACTCGAGTTTACTCTTATATTGGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014810.2-4016s1c1
Sequence:CCGGGCCTCCAACTATAACAGGATTCTCGAGAATCCTGTTATAGTTGGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014810
VALIDATED
CEP350 MISSION shRNA shRNA Plasmid DNA
centrosomal protein 350kDa
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000330114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014810.4-4233s21c1
Sequence:CCGGCCTCCAACTATAACAGGATTTCTCGAGAAATCCTGTTATAGTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014810.4-891s21c1
Sequence:CCGGAGTCGAGAAGAACGGAATATACTCGAGTATATTCCGTTCTTCTCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330041    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014810.4-9928s21c1
Sequence:CCGGCACTGGATTAATGGGTTATTTCTCGAGAAATAACCCATTAATCCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014810.4-8139s21c1
Sequence:CCGGGAACGATATCAGTGCTATAATCTCGAGATTATAGCACTGATATCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014810.4-2819s21c1
Sequence:CCGGACCTAGTGCCAGCCAATATAACTCGAGTTATATTGGCTGGCACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130933    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014810.2-9339s1c1
Sequence:CCGGCGAGTGGATCATATCCTGGTTCTCGAGAACCAGGATATGATCCACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014810.2-4017s1c1
Sequence:CCGGCCTCCAACTATAACAGGATTTCTCGAGAAATCCTGTTATAGTTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128781    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014810.2-10270s1c1
Sequence:CCGGCCTGCACTTGTCTTACTCATTCTCGAGAATGAGTAAGACAAGTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014810.2-8594s1c1
Sequence:CCGGGCCAAGTATTTCAGGTTGCTTCTCGAGAAGCAACCTGAAATACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150047    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014810.2-11054s1c1
Sequence:CCGGCCTGGAATGTTATAGCTTCAACTCGAGTTGAAGCTATAACATTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149439    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014810.2-2863s1c1
Sequence:CCGGGCTGTGTATCTCATGCAACTTCTCGAGAAGTTGCATGAGATACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014810.2-1097s1c1
Sequence:CCGGCCATCCAGTAATGGTTGTTAACTCGAGTTAACAACCATTACTGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014810.2-2610s1c1
Sequence:CCGGGCCAGCCAATATAAGAGTAAACTCGAGTTTACTCTTATATTGGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014810.2-4016s1c1
Sequence:CCGGGCCTCCAACTATAACAGGATTCTCGAGAATCCTGTTATAGTTGGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014810
VALIDATED
CEP350 MISSION shRNA Lentiviral Transduction Particles
centrosomal protein 350kDa
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000330114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014810.4-4233s21c1
Sequence:CCGGCCTCCAACTATAACAGGATTTCTCGAGAAATCCTGTTATAGTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014810.4-891s21c1
Sequence:CCGGAGTCGAGAAGAACGGAATATACTCGAGTATATTCCGTTCTTCTCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330041    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014810.4-9928s21c1
Sequence:CCGGCACTGGATTAATGGGTTATTTCTCGAGAAATAACCCATTAATCCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014810.4-8139s21c1
Sequence:CCGGGAACGATATCAGTGCTATAATCTCGAGATTATAGCACTGATATCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014810.4-2819s21c1
Sequence:CCGGACCTAGTGCCAGCCAATATAACTCGAGTTATATTGGCTGGCACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130933    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014810.2-9339s1c1
Sequence:CCGGCGAGTGGATCATATCCTGGTTCTCGAGAACCAGGATATGATCCACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014810.2-4017s1c1
Sequence:CCGGCCTCCAACTATAACAGGATTTCTCGAGAAATCCTGTTATAGTTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128781    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014810.2-10270s1c1
Sequence:CCGGCCTGCACTTGTCTTACTCATTCTCGAGAATGAGTAAGACAAGTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014810.2-8594s1c1
Sequence:CCGGGCCAAGTATTTCAGGTTGCTTCTCGAGAAGCAACCTGAAATACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150047    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014810.2-11054s1c1
Sequence:CCGGCCTGGAATGTTATAGCTTCAACTCGAGTTGAAGCTATAACATTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149439    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014810.2-2863s1c1
Sequence:CCGGGCTGTGTATCTCATGCAACTTCTCGAGAAGTTGCATGAGATACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014810.2-1097s1c1
Sequence:CCGGCCATCCAGTAATGGTTGTTAACTCGAGTTAACAACCATTACTGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014810.2-2610s1c1
Sequence:CCGGGCCAGCCAATATAAGAGTAAACTCGAGTTTACTCTTATATTGGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014810.2-4016s1c1
Sequence:CCGGGCCTCCAACTATAACAGGATTCTCGAGAATCCTGTTATAGTTGGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks