EMAIL THIS PAGE TO A FRIEND

CEP41

centrosomal protein 41kDa

188 Gene Product Result for
Synonyms: JBTS15 TSGA14
Gene ID:
Human(95681) Summary: This gene encodes a centrosomal and microtubule-binding protein which is predicted to have two coiled-coil domains and a rhodanese domain. In human retinal pigment epithelial cells the protein localized to centrioles and cilia. Mutations in this gene have been associated with Joubert Syndrome 15; an autosomal recessive ciliopathy and neurological disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2012]
Mouse(83922) centrosomal protein 41
Rat(500069) centrosomal protein 41
domestic guinea pig(100712668) centrosomal protein 41kDa
naked mole-rat(101698536) centrosomal protein 41kDa
sheep(101117581) centrosomal protein 41kDa
Zebrafish(431741) centrosomal protein 41
dog(482256) centrosomal protein 41kDa
cow(506914) centrosomal protein 41kDa
domestic cat(101090341) centrosomal protein 41kDa
chicken(416684) centrosomal protein 41kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018718 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018718 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018718 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_031998 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031998 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031998 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU093911 MISSION® esiRNA esiRNA human TSGA14 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018718 Rosetta Predictions human pricing
NM_001025770 Rosetta Predictions rat pricing
NM_031998 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018718 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00098062 predicted 641
2 SASI_Hs02_00352259 predicted 969
3 SASI_Hs02_00352260 predicted 790
4 SASI_Hs01_00098063 predicted 628
5 SASI_Hs01_00098064 predicted 1005
6 SASI_Hs01_00098065 predicted 696
7 SASI_Hs01_00098066 predicted 567
8 SASI_Hs01_00098068 predicted 1023
9 SASI_Hs01_00098069 predicted 317
10 SASI_Hs01_00098071 predicted 525
11 SASI_Hs01_00098067 predicted 660
12 SASI_Hs01_00098070 predicted 1230
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025770 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00117518 predicted 237
2 SASI_Rn01_00117519 predicted 1290
3 SASI_Rn01_00117521 predicted 948
4 SASI_Rn01_00117522 predicted 574
5 SASI_Rn01_00117523 predicted 611
6 SASI_Rn01_00117524 predicted 587
7 SASI_Rn01_00117525 predicted 1298
8 SASI_Rn01_00117526 predicted 584
9 SASI_Rn01_00117527 predicted 1377
10 SASI_Rn02_00203448 predicted 916
11 SASI_Rn01_00117520 predicted 275
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031998 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00132212 predicted 988
2 SASI_Mm01_00132213 predicted 717
3 SASI_Mm01_00132214 predicted 1206
4 SASI_Mm01_00132215 predicted 668
5 SASI_Mm01_00132216 predicted 972
6 SASI_Mm02_00337200 predicted 537
7 SASI_Mm01_00132217 predicted 1329
8 SASI_Mm02_00337201 predicted 1347
9 SASI_Mm01_00132218 predicted 461
10 SASI_Mm01_00132219 predicted 897
11 SASI_Mm01_00132211 predicted 1140
12 SASI_Mm01_00132220 predicted 768
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018718
VALIDATED
CEP41 MISSION shRNA Bacterial Glycerol Stock
centrosomal protein 41kDa
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_018718.1-108s1c1
Sequence:CCGGCCAAGATACCAGCATATCAAACTCGAGTTTGATATGCTGGTATCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144293    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_018718.1-2003s1c1
Sequence:CCGGCCATGTTAGATGGACAGAAATCTCGAGATTTCTGTCCATCTAACATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018718.1-621s1c1
Sequence:CCGGGCTTACAGTTACCCAATTGCACTCGAGTGCAATTGGGTAACTGTAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018718.1-581s1c1
Sequence:CCGGGCGTGATAGAGATTCTTACCACTCGAGTGGTAAGAATCTCTATCACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_018718.1-410s1c1
Sequence:CCGGCCCTGAGCAGTTCATAAACAACTCGAGTTGTTTATGAACTGCTCAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018718.1-925s1c1
Sequence:CCGGCCCTACCAGCTGAGAATAAATCTCGAGATTTATTCTCAGCTGGTAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018718.1-368s1c1
Sequence:CCGGCAGGACCAATGGGAAAGGAAACTCGAGTTTCCTTTCCCATTGGTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_018718.1-832s1c1
Sequence:CCGGCGGAAGGACTGATTACTGGTTCTCGAGAACCAGTAATCAGTCCTTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018718.1-652s1c1
Sequence:CCGGGAACAATGAACCCTTATTCAACTCGAGTTGAATAAGGGTTCATTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018718
VALIDATED
CEP41 MISSION shRNA shRNA Plasmid DNA
centrosomal protein 41kDa
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_018718.1-108s1c1
Sequence:CCGGCCAAGATACCAGCATATCAAACTCGAGTTTGATATGCTGGTATCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144293    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_018718.1-2003s1c1
Sequence:CCGGCCATGTTAGATGGACAGAAATCTCGAGATTTCTGTCCATCTAACATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018718.1-621s1c1
Sequence:CCGGGCTTACAGTTACCCAATTGCACTCGAGTGCAATTGGGTAACTGTAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018718.1-581s1c1
Sequence:CCGGGCGTGATAGAGATTCTTACCACTCGAGTGGTAAGAATCTCTATCACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_018718.1-410s1c1
Sequence:CCGGCCCTGAGCAGTTCATAAACAACTCGAGTTGTTTATGAACTGCTCAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018718.1-925s1c1
Sequence:CCGGCCCTACCAGCTGAGAATAAATCTCGAGATTTATTCTCAGCTGGTAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018718.1-368s1c1
Sequence:CCGGCAGGACCAATGGGAAAGGAAACTCGAGTTTCCTTTCCCATTGGTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_018718.1-832s1c1
Sequence:CCGGCGGAAGGACTGATTACTGGTTCTCGAGAACCAGTAATCAGTCCTTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018718.1-652s1c1
Sequence:CCGGGAACAATGAACCCTTATTCAACTCGAGTTGAATAAGGGTTCATTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018718
VALIDATED
CEP41 MISSION shRNA Lentiviral Transduction Particles
centrosomal protein 41kDa
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_018718.1-108s1c1
Sequence:CCGGCCAAGATACCAGCATATCAAACTCGAGTTTGATATGCTGGTATCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144293    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_018718.1-2003s1c1
Sequence:CCGGCCATGTTAGATGGACAGAAATCTCGAGATTTCTGTCCATCTAACATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018718.1-621s1c1
Sequence:CCGGGCTTACAGTTACCCAATTGCACTCGAGTGCAATTGGGTAACTGTAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018718.1-581s1c1
Sequence:CCGGGCGTGATAGAGATTCTTACCACTCGAGTGGTAAGAATCTCTATCACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_018718.1-410s1c1
Sequence:CCGGCCCTGAGCAGTTCATAAACAACTCGAGTTGTTTATGAACTGCTCAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018718.1-925s1c1
Sequence:CCGGCCCTACCAGCTGAGAATAAATCTCGAGATTTATTCTCAGCTGGTAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018718.1-368s1c1
Sequence:CCGGCAGGACCAATGGGAAAGGAAACTCGAGTTTCCTTTCCCATTGGTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_018718.1-832s1c1
Sequence:CCGGCGGAAGGACTGATTACTGGTTCTCGAGAACCAGTAATCAGTCCTTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018718.1-652s1c1
Sequence:CCGGGAACAATGAACCCTTATTCAACTCGAGTTGAATAAGGGTTCATTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031998
VALIDATED
CEP41 MISSION shRNA Bacterial Glycerol Stock
centrosomal protein 41kDa
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000180227    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031998.2-997s1c1
Sequence:CCGGCCAGAATAACTCTGCTGGAAACTCGAGTTTCCAGCAGAGTTATTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180048    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031998.2-68s1c1
Sequence:CCGGCAGAACCCAAGGTATCAACATCTCGAGATGTTGATACCTTGGGTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196119    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031998.2-461s1c1
Sequence:CCGGGATGTAGACAAAGGGCTCGTACTCGAGTACGAGCCCTTTGTCTACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_031998.2-986s21c1
Sequence:CCGGAGCCGACTGAACCAGAATAACCTCGAGGTTATTCTGGTTCAGTCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_031998.2-463s21c1
Sequence:CCGGTGTAGACAAAGGGCTCGTAAACTCGAGTTTACGAGCCCTTTGTCTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248721    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_031998.2-1910s21c1
Sequence:CCGGATGTGAGTCCAGCTATGTTAACTCGAGTTAACATAGCTGGACTCACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216193    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031998.2-2718s1c1
Sequence:CCGGCAACGTACACATAGCTTTAATCTCGAGATTAAAGCTATGTGTACGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_031998.2-545s21c1
Sequence:CCGGGTTCGAGACAGAGATTCTTATCTCGAGATAAGAATCTCTGTCTCGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_031998.2-109s21c1
Sequence:CCGGTGGTAACAGCATGACCAAATACTCGAGTATTTGGTCATGCTGTTACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031998
VALIDATED
CEP41 MISSION shRNA shRNA Plasmid DNA
centrosomal protein 41kDa
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000180227    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031998.2-997s1c1
Sequence:CCGGCCAGAATAACTCTGCTGGAAACTCGAGTTTCCAGCAGAGTTATTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180048    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031998.2-68s1c1
Sequence:CCGGCAGAACCCAAGGTATCAACATCTCGAGATGTTGATACCTTGGGTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196119    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031998.2-461s1c1
Sequence:CCGGGATGTAGACAAAGGGCTCGTACTCGAGTACGAGCCCTTTGTCTACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_031998.2-986s21c1
Sequence:CCGGAGCCGACTGAACCAGAATAACCTCGAGGTTATTCTGGTTCAGTCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_031998.2-463s21c1
Sequence:CCGGTGTAGACAAAGGGCTCGTAAACTCGAGTTTACGAGCCCTTTGTCTACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248721    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_031998.2-1910s21c1
Sequence:CCGGATGTGAGTCCAGCTATGTTAACTCGAGTTAACATAGCTGGACTCACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216193    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031998.2-2718s1c1
Sequence:CCGGCAACGTACACATAGCTTTAATCTCGAGATTAAAGCTATGTGTACGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_031998.2-545s21c1
Sequence:CCGGGTTCGAGACAGAGATTCTTATCTCGAGATAAGAATCTCTGTCTCGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_031998.2-109s21c1
Sequence:CCGGTGGTAACAGCATGACCAAATACTCGAGTATTTGGTCATGCTGTTACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031998
VALIDATED
CEP41 MISSION shRNA Lentiviral Transduction Particles
centrosomal protein 41kDa
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000180227    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031998.2-997s1c1
Sequence:CCGGCCAGAATAACTCTGCTGGAAACTCGAGTTTCCAGCAGAGTTATTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180048    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031998.2-68s1c1
Sequence:CCGGCAGAACCCAAGGTATCAACATCTCGAGATGTTGATACCTTGGGTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196119    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031998.2-461s1c1
Sequence:CCGGGATGTAGACAAAGGGCTCGTACTCGAGTACGAGCCCTTTGTCTACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_031998.2-986s21c1
Sequence:CCGGAGCCGACTGAACCAGAATAACCTCGAGGTTATTCTGGTTCAGTCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_031998.2-463s21c1
Sequence:CCGGTGTAGACAAAGGGCTCGTAAACTCGAGTTTACGAGCCCTTTGTCTACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248721    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_031998.2-1910s21c1
Sequence:CCGGATGTGAGTCCAGCTATGTTAACTCGAGTTAACATAGCTGGACTCACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216193    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031998.2-2718s1c1
Sequence:CCGGCAACGTACACATAGCTTTAATCTCGAGATTAAAGCTATGTGTACGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_031998.2-545s21c1
Sequence:CCGGGTTCGAGACAGAGATTCTTATCTCGAGATAAGAATCTCTGTCTCGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_031998.2-109s21c1
Sequence:CCGGTGGTAACAGCATGACCAAATACTCGAGTATTTGGTCATGCTGTTACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)