EMAIL THIS PAGE TO A FRIEND

CEP44

centrosomal protein 44kDa

Synonyms: KIAA1712 PS1TP3
UniProtKB ID: Q9C0F1, A8K8W9, A8MW11, B3KT53, D3DP42, Q8IXZ4
Gene ID:
Mouse(382010) centrosomal protein 44
Rat(290722) centrosomal protein 44
Zebrafish(767769) centrosomal protein 44
dog(477360) centrosomal protein 44kDa
domestic cat(101090608) centrosomal protein 44kDa
Horse(100061062) centrosomal protein 44kDa
cow(510950) centrosomal protein 44kDa
chicken(422566) centrosomal protein 44kDa
sheep(101120139) centrosomal protein 44kDa
naked mole-rat(101713713) centrosomal protein 44kDa
domestic guinea pig(100723263) centrosomal protein 44kDa
118 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001145314 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001145314 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001145314 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001009951 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001009951 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001009951 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_030633 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030633 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030633 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040157 Rosetta Predictions human pricing
NM_001037181 Rosetta Predictions rat pricing
NM_001009951 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040157 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00057563 predicted 737
2 SASI_Hs01_00057564 predicted 524
3 SASI_Hs01_00057565 predicted 558
4 SASI_Hs01_00057566 predicted 595
5 SASI_Hs01_00057567 predicted 1013
6 SASI_Hs01_00057568 predicted 894
7 SASI_Hs01_00057569 predicted 1531
8 SASI_Hs01_00057570 predicted 608
9 SASI_Hs02_00308861 predicted 1353
10 SASI_Hs02_00308862 predicted 488
11 SASI_Hs01_00057571 predicted 702
12 SASI_Hs01_00057572 predicted 535
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037181 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00204248 predicted 702
2 SASI_Rn01_00115327 predicted 410
3 SASI_Rn01_00115328 predicted 380
4 SASI_Rn01_00115329 predicted 1009
5 SASI_Rn01_00115330 predicted 287
6 SASI_Rn01_00115331 predicted 431
7 SASI_Rn02_00204249 predicted 498
8 SASI_Rn01_00115332 predicted 262
9 SASI_Rn01_00115333 predicted 1098
10 SASI_Rn01_00115334 predicted 455
11 SASI_Rn01_00115326 predicted 909
12 SASI_Rn01_00115335 predicted 581
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009951 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00067636 predicted 431
2 SASI_Mm01_00067637 predicted 949
3 SASI_Mm01_00067638 predicted 379
4 SASI_Mm01_00067639 predicted 960
5 SASI_Mm01_00067640 predicted 350
6 SASI_Mm01_00067641 predicted 393
7 SASI_Mm01_00067642 predicted 278
8 SASI_Mm01_00067643 predicted 263
9 SASI_Mm01_00067644 predicted 220
10 SASI_Mm01_00067645 predicted 863
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001145314
CEP44 MISSION shRNA Bacterial Glycerol Stock
centrosomal protein 44kDa
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000431059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145314.1-445s21c1
Sequence:CCGGTTACCTCATACTCACCTTATGCTCGAGCATAAGGTGAGTATGAGGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145314.1-906s21c1
Sequence:CCGGGTTGATGTGTCTGACTTAAATCTCGAGATTTAAGTCAGACACATCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145314.1-422s21c1
Sequence:CCGGTTTGCCCATCATCAGCTATTCCTCGAGGAATAGCTGATGATGGGCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001145314
CEP44 MISSION shRNA shRNA Plasmid DNA
centrosomal protein 44kDa
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000431059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145314.1-445s21c1
Sequence:CCGGTTACCTCATACTCACCTTATGCTCGAGCATAAGGTGAGTATGAGGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145314.1-906s21c1
Sequence:CCGGGTTGATGTGTCTGACTTAAATCTCGAGATTTAAGTCAGACACATCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145314.1-422s21c1
Sequence:CCGGTTTGCCCATCATCAGCTATTCCTCGAGGAATAGCTGATGATGGGCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001145314
CEP44 MISSION shRNA Lentiviral Transduction Particles
centrosomal protein 44kDa
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000431059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145314.1-445s21c1
Sequence:CCGGTTACCTCATACTCACCTTATGCTCGAGCATAAGGTGAGTATGAGGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145314.1-906s21c1
Sequence:CCGGGTTGATGTGTCTGACTTAAATCTCGAGATTTAAGTCAGACACATCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145314.1-422s21c1
Sequence:CCGGTTTGCCCATCATCAGCTATTCCTCGAGGAATAGCTGATGATGGGCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001009951
VALIDATED
CEP44 MISSION shRNA Bacterial Glycerol Stock
centrosomal protein 44kDa
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000198923    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009951.1-283s1c1
Sequence:CCGGGCGCTTTACAGATACTGTCTACTCGAGTAGACAGTATCTGTAAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198270    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009951.1-981s1c1
Sequence:CCGGGTCAAGACTGTGAGTCAATTACTCGAGTAATTGACTCACAGTCTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001009951.1-685s1c1
Sequence:CCGGGCAGAGTTCTGACATTCGGATCTCGAGATCCGAATGTCAGAACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181468    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001009951.1-1257s1c1
Sequence:CCGGCCTAGGACTTTGGCTACTTATCTCGAGATAAGTAGCCAAAGTCCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009951.1-740s1c1
Sequence:CCGGCTGCAAGATATATGTGATCATCTCGAGATGATCACATATATCTTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001009951.1-1203s1c1
Sequence:CCGGCAGAGTTACTGAAATGCTCAACTCGAGTTGAGCATTTCAGTAACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001009951.1-234s1c1
Sequence:CCGGCCGAACTCCTAATGGAATCCACTCGAGTGGATTCCATTAGGAGTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001009951
VALIDATED
CEP44 MISSION shRNA shRNA Plasmid DNA
centrosomal protein 44kDa
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000198923    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009951.1-283s1c1
Sequence:CCGGGCGCTTTACAGATACTGTCTACTCGAGTAGACAGTATCTGTAAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198270    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009951.1-981s1c1
Sequence:CCGGGTCAAGACTGTGAGTCAATTACTCGAGTAATTGACTCACAGTCTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001009951.1-685s1c1
Sequence:CCGGGCAGAGTTCTGACATTCGGATCTCGAGATCCGAATGTCAGAACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181468    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001009951.1-1257s1c1
Sequence:CCGGCCTAGGACTTTGGCTACTTATCTCGAGATAAGTAGCCAAAGTCCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009951.1-740s1c1
Sequence:CCGGCTGCAAGATATATGTGATCATCTCGAGATGATCACATATATCTTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001009951.1-1203s1c1
Sequence:CCGGCAGAGTTACTGAAATGCTCAACTCGAGTTGAGCATTTCAGTAACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001009951.1-234s1c1
Sequence:CCGGCCGAACTCCTAATGGAATCCACTCGAGTGGATTCCATTAGGAGTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001009951
VALIDATED
CEP44 MISSION shRNA Lentiviral Transduction Particles
centrosomal protein 44kDa
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000198923    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009951.1-283s1c1
Sequence:CCGGGCGCTTTACAGATACTGTCTACTCGAGTAGACAGTATCTGTAAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198270    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009951.1-981s1c1
Sequence:CCGGGTCAAGACTGTGAGTCAATTACTCGAGTAATTGACTCACAGTCTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001009951.1-685s1c1
Sequence:CCGGGCAGAGTTCTGACATTCGGATCTCGAGATCCGAATGTCAGAACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181468    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001009951.1-1257s1c1
Sequence:CCGGCCTAGGACTTTGGCTACTTATCTCGAGATAAGTAGCCAAAGTCCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009951.1-740s1c1
Sequence:CCGGCTGCAAGATATATGTGATCATCTCGAGATGATCACATATATCTTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001009951.1-1203s1c1
Sequence:CCGGCAGAGTTACTGAAATGCTCAACTCGAGTTGAGCATTTCAGTAACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001009951.1-234s1c1
Sequence:CCGGCCGAACTCCTAATGGAATCCACTCGAGTGGATTCCATTAGGAGTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030633
VALIDATED
CEP44 MISSION shRNA Bacterial Glycerol Stock
centrosomal protein 44kDa
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_030633.1-1309s1c1
Sequence:CCGGCCTCTGGCTATAGTACAGCATCTCGAGATGCTGTACTATAGCCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167741    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_030633.1-1776s1c1
Sequence:CCGGGCAGTGTGCTAAGTAATGTTTCTCGAGAAACATTACTTAGCACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_030633.1-1446s1c1
Sequence:CCGGGAGTTACTGAAATGTCCAAATCTCGAGATTTGGACATTTCAGTAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167272    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_030633.1-2436s1c1
Sequence:CCGGCCAGTGTAACAGAAAGAGAATCTCGAGATTCTCTTTCTGTTACACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_030633.1-867s1c1
Sequence:CCGGGAGGATACATTAAGTCCAATACTCGAGTATTGGACTTAATGTATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030633
VALIDATED
CEP44 MISSION shRNA shRNA Plasmid DNA
centrosomal protein 44kDa
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_030633.1-1309s1c1
Sequence:CCGGCCTCTGGCTATAGTACAGCATCTCGAGATGCTGTACTATAGCCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167741    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_030633.1-1776s1c1
Sequence:CCGGGCAGTGTGCTAAGTAATGTTTCTCGAGAAACATTACTTAGCACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_030633.1-1446s1c1
Sequence:CCGGGAGTTACTGAAATGTCCAAATCTCGAGATTTGGACATTTCAGTAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167272    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_030633.1-2436s1c1
Sequence:CCGGCCAGTGTAACAGAAAGAGAATCTCGAGATTCTCTTTCTGTTACACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_030633.1-867s1c1
Sequence:CCGGGAGGATACATTAAGTCCAATACTCGAGTATTGGACTTAATGTATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030633
VALIDATED
CEP44 MISSION shRNA Lentiviral Transduction Particles
centrosomal protein 44kDa
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_030633.1-1309s1c1
Sequence:CCGGCCTCTGGCTATAGTACAGCATCTCGAGATGCTGTACTATAGCCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167741    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_030633.1-1776s1c1
Sequence:CCGGGCAGTGTGCTAAGTAATGTTTCTCGAGAAACATTACTTAGCACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_030633.1-1446s1c1
Sequence:CCGGGAGTTACTGAAATGTCCAAATCTCGAGATTTGGACATTTCAGTAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167272    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_030633.1-2436s1c1
Sequence:CCGGCCAGTGTAACAGAAAGAGAATCTCGAGATTCTCTTTCTGTTACACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_030633.1-867s1c1
Sequence:CCGGGAGGATACATTAAGTCCAATACTCGAGTATTGGACTTAATGTATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks