EMAIL THIS PAGE TO A FRIEND

CEP55

centrosomal protein 55kDa

Synonyms: C10orf3 CT111 URCC6
Gene ID:
Mouse(74107) centrosomal protein 55
Rat(294074) centrosomal protein 55
domestic guinea pig(100725429) centrosomal protein 55kDa
naked mole-rat(101700227) centrosomal protein 55kDa
sheep(101104542) centrosomal protein 55kDa
chicken(423804) centrosomal protein 55kDa
dog(608315) centrosomal protein 55kDa
cow(513594) centrosomal protein 55kDa
Horse(100071184) centrosomal protein 55kDa
domestic cat(101094136) centrosomal protein 55kDa
dog(477773) centrosomal protein 55kDa
158 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028760 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028760 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028760 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018131 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018131 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018131 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127182 Rosetta Predictions human pricing
NM_018131 Rosetta Predictions human pricing
NM_001025646 Rosetta Predictions rat pricing
NM_028760 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127182 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328607 predicted 923
2 SASI_Hs02_00328608 predicted 454
3 SASI_Hs02_00328609 predicted 1491
4 SASI_Hs02_00328610 predicted 588
5 SASI_Hs02_00328611 predicted 1361
6 SASI_Hs02_00328612 predicted 936
7 SASI_Hs02_00328613 predicted 393
8 SASI_Hs02_00328614 predicted 1475
9 SASI_Hs02_00328615 predicted 610
10 SASI_Hs02_00328616 predicted 1164
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018131 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00351346 predicted 1043
2 SASI_Hs01_00021431 predicted 574
3 SASI_Hs01_00021432 predicted 1609
4 SASI_Hs01_00021433 predicted 705
5 SASI_Hs01_00021434 predicted 1484
6 SASI_Hs02_00351347 predicted 1060
7 SASI_Hs01_00021437 predicted 518
8 SASI_Hs02_00351348 predicted 1602
9 SASI_Hs01_00021438 predicted 733
10 SASI_Hs01_00021439 predicted 1282
11 SASI_Hs01_00021430 predicted 294
12 SASI_Hs01_00021435 predicted 341
13 SASI_Hs01_00021436 predicted 1407
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025646 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00083672 predicted 909
2 SASI_Rn02_00203221 predicted 650
3 SASI_Rn01_00083673 predicted 976
4 SASI_Rn01_00083674 predicted 398
5 SASI_Rn01_00083675 predicted 1606
6 SASI_Rn01_00083676 predicted 1570
7 SASI_Rn01_00083677 predicted 902
8 SASI_Rn01_00083678 predicted 524
9 SASI_Rn01_00083679 predicted 936
10 SASI_Rn01_00083680 predicted 1425
11 SASI_Rn01_00083681 predicted 416
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028760 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00135956 predicted 843
2 SASI_Mm01_00135957 predicted 1143
3 SASI_Mm02_00334349 predicted 646
4 SASI_Mm01_00135958 predicted 1795
5 SASI_Mm01_00135959 predicted 632
6 SASI_Mm01_00135960 predicted 1136
7 SASI_Mm01_00135961 predicted 1348
8 SASI_Mm01_00135962 predicted 638
9 SASI_Mm01_00135963 predicted 1657
10 SASI_Mm01_00135964 predicted 1200
11 SASI_Mm01_00135965 predicted 1551
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028760
VALIDATED
CEP55 MISSION shRNA Bacterial Glycerol Stock
centrosomal protein 55kDa
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028760.1-1037s1c1
Sequence:CCGGGAAGATTGAATCAGAAGGTTACTCGAGTAACCTTCTGATTCAATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028760.1-1146s1c1
Sequence:CCGGCGTTTAGAACTCGATGAATTTCTCGAGAAATTCATCGAGTTCTAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028760.1-1491s1c1
Sequence:CCGGCAGCATCAACTCTATGTGATTCTCGAGAATCACATAGAGTTGATGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179809    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028760.1-2017s1c1
Sequence:CCGGCGCTGTTCTAATGACTAGCATCTCGAGATGCTAGTCATTAGAACAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028760.2-1386s21c1
Sequence:CCGGAGAGGTCGGAGGAGCTCTTATCTCGAGATAAGAGCTCCTCCGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028760.2-1533s21c1
Sequence:CCGGATATGCAGCATCAACTCTATGCTCGAGCATAGAGTTGATGCTGCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028760.2-1179s21c1
Sequence:CCGGCCGTGACTCAGTTGCGTTTAGCTCGAGCTAAACGCAACTGAGTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028760.2-989s21c1
Sequence:CCGGCAGCGAGAGGCCTACGTTAAACTCGAGTTTAACGTAGGCCTCTCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028760.2-686s21c1
Sequence:CCGGGACCACCTAAGGTCAAGATATCTCGAGATATCTTGACCTTAGGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375943    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028760.2-2066s21c1
Sequence:CCGGCTGTTGTAATGACTAGCATTTCTCGAGAAATGCTAGTCATTACAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028760.2-1774s21c1
Sequence:CCGGCCTGCTTGTCCATGTCGAATACTCGAGTATTCGACATGGACAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028760
VALIDATED
CEP55 MISSION shRNA shRNA Plasmid DNA
centrosomal protein 55kDa
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028760.1-1037s1c1
Sequence:CCGGGAAGATTGAATCAGAAGGTTACTCGAGTAACCTTCTGATTCAATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028760.1-1146s1c1
Sequence:CCGGCGTTTAGAACTCGATGAATTTCTCGAGAAATTCATCGAGTTCTAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028760.1-1491s1c1
Sequence:CCGGCAGCATCAACTCTATGTGATTCTCGAGAATCACATAGAGTTGATGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179809    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028760.1-2017s1c1
Sequence:CCGGCGCTGTTCTAATGACTAGCATCTCGAGATGCTAGTCATTAGAACAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028760.2-1386s21c1
Sequence:CCGGAGAGGTCGGAGGAGCTCTTATCTCGAGATAAGAGCTCCTCCGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028760.2-1533s21c1
Sequence:CCGGATATGCAGCATCAACTCTATGCTCGAGCATAGAGTTGATGCTGCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028760.2-1179s21c1
Sequence:CCGGCCGTGACTCAGTTGCGTTTAGCTCGAGCTAAACGCAACTGAGTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028760.2-989s21c1
Sequence:CCGGCAGCGAGAGGCCTACGTTAAACTCGAGTTTAACGTAGGCCTCTCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028760.2-686s21c1
Sequence:CCGGGACCACCTAAGGTCAAGATATCTCGAGATATCTTGACCTTAGGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375943    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028760.2-2066s21c1
Sequence:CCGGCTGTTGTAATGACTAGCATTTCTCGAGAAATGCTAGTCATTACAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028760.2-1774s21c1
Sequence:CCGGCCTGCTTGTCCATGTCGAATACTCGAGTATTCGACATGGACAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028760
VALIDATED
CEP55 MISSION shRNA Lentiviral Transduction Particles
centrosomal protein 55kDa
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028760.1-1037s1c1
Sequence:CCGGGAAGATTGAATCAGAAGGTTACTCGAGTAACCTTCTGATTCAATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028760.1-1146s1c1
Sequence:CCGGCGTTTAGAACTCGATGAATTTCTCGAGAAATTCATCGAGTTCTAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028760.1-1491s1c1
Sequence:CCGGCAGCATCAACTCTATGTGATTCTCGAGAATCACATAGAGTTGATGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179809    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028760.1-2017s1c1
Sequence:CCGGCGCTGTTCTAATGACTAGCATCTCGAGATGCTAGTCATTAGAACAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028760.2-1386s21c1
Sequence:CCGGAGAGGTCGGAGGAGCTCTTATCTCGAGATAAGAGCTCCTCCGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028760.2-1533s21c1
Sequence:CCGGATATGCAGCATCAACTCTATGCTCGAGCATAGAGTTGATGCTGCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028760.2-1179s21c1
Sequence:CCGGCCGTGACTCAGTTGCGTTTAGCTCGAGCTAAACGCAACTGAGTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028760.2-989s21c1
Sequence:CCGGCAGCGAGAGGCCTACGTTAAACTCGAGTTTAACGTAGGCCTCTCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028760.2-686s21c1
Sequence:CCGGGACCACCTAAGGTCAAGATATCTCGAGATATCTTGACCTTAGGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375943    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028760.2-2066s21c1
Sequence:CCGGCTGTTGTAATGACTAGCATTTCTCGAGAAATGCTAGTCATTACAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028760.2-1774s21c1
Sequence:CCGGCCTGCTTGTCCATGTCGAATACTCGAGTATTCGACATGGACAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018131
VALIDATED
CEP55 MISSION shRNA Bacterial Glycerol Stock
centrosomal protein 55kDa
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018131.3-1352s1c1
Sequence:CCGGGCAGGCATGTACTTTAGACTTCTCGAGAAGTCTAAAGTACATGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018131.3-331s1c1
Sequence:CCGGCGAAGCCTAGTAACTCCAAATCTCGAGATTTGGAGTTACTAGGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_018131.3-1403s1c1
Sequence:CCGGGCAGCATCAATTGCTTGTAATCTCGAGATTACAAGCAATTGATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_018131.3-1605s1c1
Sequence:CCGGCCCAAGTGCAATATACAGTATCTCGAGATACTGTATATTGCACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_018131.3-851s1c1
Sequence:CCGGGCAGCGGGAAGTCTATGTAAACTCGAGTTTACATAGACTTCCCGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018131.4-1520s21c1
Sequence:CCGGACAGAGCCATTAGTCACTTTCCTCGAGGAAAGTGACTAATGGCTCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420242    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018131.4-2078s21c1
Sequence:CCGGATCTTAACTGTGTTCGCATTTCTCGAGAAATGCGAACACAGTTAAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426039    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018131.4-1930s21c1
Sequence:CCGGGCGTCTACTGAGACTACTAACCTCGAGGTTAGTAGTCTCAGTAGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426606    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018131.4-1993s21c1
Sequence:CCGGGGTTATTGCTAATGGGTTAATCTCGAGATTAACCCATTAGCAATAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018131
VALIDATED
CEP55 MISSION shRNA shRNA Plasmid DNA
centrosomal protein 55kDa
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018131.3-1352s1c1
Sequence:CCGGGCAGGCATGTACTTTAGACTTCTCGAGAAGTCTAAAGTACATGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018131.3-331s1c1
Sequence:CCGGCGAAGCCTAGTAACTCCAAATCTCGAGATTTGGAGTTACTAGGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_018131.3-1403s1c1
Sequence:CCGGGCAGCATCAATTGCTTGTAATCTCGAGATTACAAGCAATTGATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_018131.3-1605s1c1
Sequence:CCGGCCCAAGTGCAATATACAGTATCTCGAGATACTGTATATTGCACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_018131.3-851s1c1
Sequence:CCGGGCAGCGGGAAGTCTATGTAAACTCGAGTTTACATAGACTTCCCGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018131.4-1520s21c1
Sequence:CCGGACAGAGCCATTAGTCACTTTCCTCGAGGAAAGTGACTAATGGCTCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420242    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018131.4-2078s21c1
Sequence:CCGGATCTTAACTGTGTTCGCATTTCTCGAGAAATGCGAACACAGTTAAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426039    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018131.4-1930s21c1
Sequence:CCGGGCGTCTACTGAGACTACTAACCTCGAGGTTAGTAGTCTCAGTAGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426606    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018131.4-1993s21c1
Sequence:CCGGGGTTATTGCTAATGGGTTAATCTCGAGATTAACCCATTAGCAATAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018131
VALIDATED
CEP55 MISSION shRNA Lentiviral Transduction Particles
centrosomal protein 55kDa
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018131.3-1352s1c1
Sequence:CCGGGCAGGCATGTACTTTAGACTTCTCGAGAAGTCTAAAGTACATGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018131.3-331s1c1
Sequence:CCGGCGAAGCCTAGTAACTCCAAATCTCGAGATTTGGAGTTACTAGGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_018131.3-1403s1c1
Sequence:CCGGGCAGCATCAATTGCTTGTAATCTCGAGATTACAAGCAATTGATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_018131.3-1605s1c1
Sequence:CCGGCCCAAGTGCAATATACAGTATCTCGAGATACTGTATATTGCACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_018131.3-851s1c1
Sequence:CCGGGCAGCGGGAAGTCTATGTAAACTCGAGTTTACATAGACTTCCCGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018131.4-1520s21c1
Sequence:CCGGACAGAGCCATTAGTCACTTTCCTCGAGGAAAGTGACTAATGGCTCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420242    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018131.4-2078s21c1
Sequence:CCGGATCTTAACTGTGTTCGCATTTCTCGAGAAATGCGAACACAGTTAAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426039    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018131.4-1930s21c1
Sequence:CCGGGCGTCTACTGAGACTACTAACCTCGAGGTTAGTAGTCTCAGTAGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426606    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018131.4-1993s21c1
Sequence:CCGGGGTTATTGCTAATGGGTTAATCTCGAGATTAACCCATTAGCAATAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks