EMAIL THIS PAGE TO A FRIEND

CEP57

centrosomal protein 57kDa

118 Gene Product Result for
Synonyms: MVA2 PIG8 TSP57
Gene ID:
Human(9702) Summary: This gene encodes a cytoplasmic protein called Translokin. This protein localizes to the centrosome and has a function in microtubular stabilization. The N-terminal half of this protein is required for its centrosome localization and for its multimerization, and the C-terminal half is required for nucleating, bundling and anchoring microtubules to the centrosomes. This protein specifically interacts with fibroblast growth factor 2 (FGF2), sorting nexin 6, Ran-binding protein M and the kinesins KIF3A and KIF3B, and thus mediates the nuclear translocation and mitogenic activity of the FGF2. It also interacts with cyclin D1 and controls nucleocytoplasmic distribution of the cyclin D1 in quiescent cells. This protein is crucial for maintaining correct chromosomal number during cell division. Mutations in this gene cause mosaic variegated aneuploidy syndrome, a rare autosomal recessive disorder. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Aug 2011]
Mouse(74360) centrosomal protein 57
Rat(315423) centrosomal protein 57
Zebrafish(791201) centrosomal protein 57
domestic cat(101084902) centrosomal protein 57kDa
cow(353245) centrosomal protein 57kDa
dog(476766) centrosomal protein 57kDa
chicken(418993) centrosomal protein 57kDa
sheep(101102008) centrosomal protein 57kDa
naked mole-rat(101715850) centrosomal protein 57kDa
domestic guinea pig(100714775) centrosomal protein 57kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026665 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026665 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026665 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014679 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014679 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014679 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014679 Rosetta Predictions human pricing
NM_001108124 Rosetta Predictions rat pricing
NM_026665 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014679 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00047878 predicted 294
2 SASI_Hs01_00047881 predicted 1314
3 SASI_Hs01_00047884 predicted 541
4 SASI_Hs01_00047886 predicted 1720
5 SASI_Hs01_00047887 predicted 321
6 SASI_Hs02_00346034 predicted 264
7 SASI_Hs02_00346035 predicted 435
8 SASI_Hs02_00346036 predicted 1797
9 SASI_Hs02_00346037 predicted 543
10 SASI_Hs02_00346038 predicted 1718
11 SASI_Hs01_00047879 predicted 346
12 SASI_Hs01_00047880 predicted 522
13 SASI_Hs01_00047882 predicted 605
14 SASI_Hs01_00047883 predicted 392
15 SASI_Hs01_00047885 predicted 1788
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108124 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00235594 predicted 1373
2 SASI_Rn02_00235595 predicted 311
3 SASI_Rn02_00235596 predicted 1728
4 SASI_Rn02_00235597 predicted 1235
5 SASI_Rn02_00235598 predicted 1281
6 SASI_Rn02_00235599 predicted 1378
7 SASI_Rn02_00235600 predicted 1732
8 SASI_Rn02_00235601 predicted 1571
9 SASI_Rn02_00235602 predicted 256
10 SASI_Rn02_00235603 predicted 1664
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026665 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00066187 predicted 353
2 SASI_Mm01_00066188 predicted 1202
3 SASI_Mm01_00066190 predicted 471
4 SASI_Mm02_00330659 predicted 258
5 SASI_Mm01_00066192 predicted 484
6 SASI_Mm01_00066193 predicted 300
7 SASI_Mm01_00066194 predicted 1190
8 SASI_Mm02_00330660 predicted 273
9 SASI_Mm01_00066195 predicted 1786
10 SASI_Mm01_00066196 predicted 268
11 SASI_Mm01_00066189 predicted 209
12 SASI_Mm01_00066191 predicted 222
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026665
VALIDATED
CEP57 MISSION shRNA Bacterial Glycerol Stock
centrosomal protein 57kDa
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026665.3-712s21c1
Sequence:CCGGAGAACGGCAGCATGATCAAACCTCGAGGTTTGATCATGCTGCCGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026665.3-1042s21c1
Sequence:CCGGCAGATTGTGCTTAGGTGATATCTCGAGATATCACCTAAGCACAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427968    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026665.3-1713s21c1
Sequence:CCGGATGTACCTCACTGGTCATAAACTCGAGTTTATGACCAGTGAGGTACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026665.3-631s21c1
Sequence:CCGGATTGGAATACATGCGAAATATCTCGAGATATTTCGCATGTATTCCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120987    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026665.2-2291s1c1
Sequence:CCGGGCACTGTTTAATCTTGACTTACTCGAGTAAGTCAAGATTAAACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026665.2-1284s1c1
Sequence:CCGGCAGCAGCTTACTAAACTCATACTCGAGTATGAGTTTAGTAAGCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026665.2-1210s1c1
Sequence:CCGGGCAGTGTTAATGAAGAACTTTCTCGAGAAAGTTCTTCATTAACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026665.2-270s1c1
Sequence:CCGGCCACCTGATAAGCCTTTCCTTCTCGAGAAGGAAAGGCTTATCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026665.2-1383s1c1
Sequence:CCGGGCCAATCAGATAACTAAAGTTCTCGAGAACTTTAGTTATCTGATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026665
VALIDATED
CEP57 MISSION shRNA shRNA Plasmid DNA
centrosomal protein 57kDa
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026665.3-712s21c1
Sequence:CCGGAGAACGGCAGCATGATCAAACCTCGAGGTTTGATCATGCTGCCGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026665.3-1042s21c1
Sequence:CCGGCAGATTGTGCTTAGGTGATATCTCGAGATATCACCTAAGCACAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427968    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026665.3-1713s21c1
Sequence:CCGGATGTACCTCACTGGTCATAAACTCGAGTTTATGACCAGTGAGGTACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026665.3-631s21c1
Sequence:CCGGATTGGAATACATGCGAAATATCTCGAGATATTTCGCATGTATTCCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120987    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026665.2-2291s1c1
Sequence:CCGGGCACTGTTTAATCTTGACTTACTCGAGTAAGTCAAGATTAAACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026665.2-1284s1c1
Sequence:CCGGCAGCAGCTTACTAAACTCATACTCGAGTATGAGTTTAGTAAGCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026665.2-1210s1c1
Sequence:CCGGGCAGTGTTAATGAAGAACTTTCTCGAGAAAGTTCTTCATTAACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026665.2-270s1c1
Sequence:CCGGCCACCTGATAAGCCTTTCCTTCTCGAGAAGGAAAGGCTTATCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026665.2-1383s1c1
Sequence:CCGGGCCAATCAGATAACTAAAGTTCTCGAGAACTTTAGTTATCTGATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026665
VALIDATED
CEP57 MISSION shRNA Lentiviral Transduction Particles
centrosomal protein 57kDa
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026665.3-712s21c1
Sequence:CCGGAGAACGGCAGCATGATCAAACCTCGAGGTTTGATCATGCTGCCGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026665.3-1042s21c1
Sequence:CCGGCAGATTGTGCTTAGGTGATATCTCGAGATATCACCTAAGCACAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427968    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026665.3-1713s21c1
Sequence:CCGGATGTACCTCACTGGTCATAAACTCGAGTTTATGACCAGTGAGGTACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026665.3-631s21c1
Sequence:CCGGATTGGAATACATGCGAAATATCTCGAGATATTTCGCATGTATTCCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120987    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026665.2-2291s1c1
Sequence:CCGGGCACTGTTTAATCTTGACTTACTCGAGTAAGTCAAGATTAAACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026665.2-1284s1c1
Sequence:CCGGCAGCAGCTTACTAAACTCATACTCGAGTATGAGTTTAGTAAGCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026665.2-1210s1c1
Sequence:CCGGGCAGTGTTAATGAAGAACTTTCTCGAGAAAGTTCTTCATTAACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026665.2-270s1c1
Sequence:CCGGCCACCTGATAAGCCTTTCCTTCTCGAGAAGGAAAGGCTTATCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026665.2-1383s1c1
Sequence:CCGGGCCAATCAGATAACTAAAGTTCTCGAGAACTTTAGTTATCTGATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014679
VALIDATED
CEP57 MISSION shRNA Bacterial Glycerol Stock
centrosomal protein 57kDa
Human
18 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000278860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014679.3-552s21c1
Sequence:CCGGCAGATACAAGAAAGGGAGAATCTCGAGATTCTCCCTTTCTTGTATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014679.3-339s21c1
Sequence:CCGGCCTTCGGATAAGCCTTTCCTTCTCGAGAAGGAAAGGCTTATCCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014679.3-1191s21c1
Sequence:CCGGGATCGAGTCATCAACAGTATTCTCGAGAATACTGTTGATGACTCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014679.3-309s21c1
Sequence:CCGGCGGCATTCTTCATCTCCATATCTCGAGATATGGAGATGAAGAATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014679.3-276s21c1
Sequence:CCGGGCTGAGCCATCAAGGTCTAATCTCGAGATTAGACCTTGATGGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145516    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014679.2-1880s1c1
Sequence:CCGGGCAGGATGACTCAATGTTAAACTCGAGTTTAACATTGAGTCATCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014679.2-552s1c1
Sequence:CCGGCAGATACAAGAAAGGGAGAATCTCGAGATTCTCCCTTTCTTGTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144002    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014679.2-1656s1c1
Sequence:CCGGCAGTTATTGAAGGACATGCAACTCGAGTTGCATGTCCTTCAATAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144880    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014679.2-789s1c1
Sequence:CCGGGATCTTCTTGAACAGGAGTATCTCGAGATACTCCTGTTCAAGAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122750    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014679.2-1795s1c1
Sequence:CCGGCCAGGTCTCATACTCACTTATCTCGAGATAAGTGAGTATGAGACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014679.2-1191s1c1
Sequence:CCGGGATCGAGTCATCAACAGTATTCTCGAGAATACTGTTGATGACTCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014679.2-744s1c1
Sequence:CCGGCGACAACATGATCAAACACATCTCGAGATGTGTTTGATCATGTTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014679.2-1314s1c1
Sequence:CCGGCAGACTTTACAGGATGAATTTCTCGAGAAATTCATCCTGTAAAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143673    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014679.2-1413s1c1
Sequence:CCGGGAGTGTGAATTGGAGGCATTACTCGAGTAATGCCTCCAATTCACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142782    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014679.2-486s1c1
Sequence:CCGGCAGGCAGAAGAAAGTGTGAAACTCGAGTTTCACACTTTCTTCTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014679.2-276s1c1
Sequence:CCGGGCTGAGCCATCAAGGTCTAATCTCGAGATTAGACCTTGATGGCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014679.2-309s1c1
Sequence:CCGGCGGCATTCTTCATCTCCATATCTCGAGATATGGAGATGAAGAATGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014679.2-339s1c1
Sequence:CCGGCCTTCGGATAAGCCTTTCCTTCTCGAGAAGGAAAGGCTTATCCGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014679
VALIDATED
CEP57 MISSION shRNA shRNA Plasmid DNA
centrosomal protein 57kDa
Human
18 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000278860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014679.3-552s21c1
Sequence:CCGGCAGATACAAGAAAGGGAGAATCTCGAGATTCTCCCTTTCTTGTATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014679.3-339s21c1
Sequence:CCGGCCTTCGGATAAGCCTTTCCTTCTCGAGAAGGAAAGGCTTATCCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014679.3-1191s21c1
Sequence:CCGGGATCGAGTCATCAACAGTATTCTCGAGAATACTGTTGATGACTCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014679.3-309s21c1
Sequence:CCGGCGGCATTCTTCATCTCCATATCTCGAGATATGGAGATGAAGAATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014679.3-276s21c1
Sequence:CCGGGCTGAGCCATCAAGGTCTAATCTCGAGATTAGACCTTGATGGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145516    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014679.2-1880s1c1
Sequence:CCGGGCAGGATGACTCAATGTTAAACTCGAGTTTAACATTGAGTCATCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014679.2-552s1c1
Sequence:CCGGCAGATACAAGAAAGGGAGAATCTCGAGATTCTCCCTTTCTTGTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144002    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014679.2-1656s1c1
Sequence:CCGGCAGTTATTGAAGGACATGCAACTCGAGTTGCATGTCCTTCAATAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144880    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014679.2-789s1c1
Sequence:CCGGGATCTTCTTGAACAGGAGTATCTCGAGATACTCCTGTTCAAGAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122750    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014679.2-1795s1c1
Sequence:CCGGCCAGGTCTCATACTCACTTATCTCGAGATAAGTGAGTATGAGACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014679.2-1191s1c1
Sequence:CCGGGATCGAGTCATCAACAGTATTCTCGAGAATACTGTTGATGACTCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014679.2-744s1c1
Sequence:CCGGCGACAACATGATCAAACACATCTCGAGATGTGTTTGATCATGTTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014679.2-1314s1c1
Sequence:CCGGCAGACTTTACAGGATGAATTTCTCGAGAAATTCATCCTGTAAAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143673    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014679.2-1413s1c1
Sequence:CCGGGAGTGTGAATTGGAGGCATTACTCGAGTAATGCCTCCAATTCACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142782    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014679.2-486s1c1
Sequence:CCGGCAGGCAGAAGAAAGTGTGAAACTCGAGTTTCACACTTTCTTCTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014679.2-276s1c1
Sequence:CCGGGCTGAGCCATCAAGGTCTAATCTCGAGATTAGACCTTGATGGCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014679.2-309s1c1
Sequence:CCGGCGGCATTCTTCATCTCCATATCTCGAGATATGGAGATGAAGAATGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014679.2-339s1c1
Sequence:CCGGCCTTCGGATAAGCCTTTCCTTCTCGAGAAGGAAAGGCTTATCCGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014679
VALIDATED
CEP57 MISSION shRNA Lentiviral Transduction Particles
centrosomal protein 57kDa
Human
18 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000278860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014679.3-552s21c1
Sequence:CCGGCAGATACAAGAAAGGGAGAATCTCGAGATTCTCCCTTTCTTGTATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014679.3-339s21c1
Sequence:CCGGCCTTCGGATAAGCCTTTCCTTCTCGAGAAGGAAAGGCTTATCCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014679.3-1191s21c1
Sequence:CCGGGATCGAGTCATCAACAGTATTCTCGAGAATACTGTTGATGACTCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014679.3-309s21c1
Sequence:CCGGCGGCATTCTTCATCTCCATATCTCGAGATATGGAGATGAAGAATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014679.3-276s21c1
Sequence:CCGGGCTGAGCCATCAAGGTCTAATCTCGAGATTAGACCTTGATGGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145516    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014679.2-1880s1c1
Sequence:CCGGGCAGGATGACTCAATGTTAAACTCGAGTTTAACATTGAGTCATCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014679.2-552s1c1
Sequence:CCGGCAGATACAAGAAAGGGAGAATCTCGAGATTCTCCCTTTCTTGTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144002    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014679.2-1656s1c1
Sequence:CCGGCAGTTATTGAAGGACATGCAACTCGAGTTGCATGTCCTTCAATAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144880    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014679.2-789s1c1
Sequence:CCGGGATCTTCTTGAACAGGAGTATCTCGAGATACTCCTGTTCAAGAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122750    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014679.2-1795s1c1
Sequence:CCGGCCAGGTCTCATACTCACTTATCTCGAGATAAGTGAGTATGAGACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014679.2-1191s1c1
Sequence:CCGGGATCGAGTCATCAACAGTATTCTCGAGAATACTGTTGATGACTCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014679.2-744s1c1
Sequence:CCGGCGACAACATGATCAAACACATCTCGAGATGTGTTTGATCATGTTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014679.2-1314s1c1
Sequence:CCGGCAGACTTTACAGGATGAATTTCTCGAGAAATTCATCCTGTAAAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143673    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014679.2-1413s1c1
Sequence:CCGGGAGTGTGAATTGGAGGCATTACTCGAGTAATGCCTCCAATTCACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142782    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014679.2-486s1c1
Sequence:CCGGCAGGCAGAAGAAAGTGTGAAACTCGAGTTTCACACTTTCTTCTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014679.2-276s1c1
Sequence:CCGGGCTGAGCCATCAAGGTCTAATCTCGAGATTAGACCTTGATGGCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014679.2-309s1c1
Sequence:CCGGCGGCATTCTTCATCTCCATATCTCGAGATATGGAGATGAAGAATGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014679.2-339s1c1
Sequence:CCGGCCTTCGGATAAGCCTTTCCTTCTCGAGAAGGAAAGGCTTATCCGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks