EMAIL THIS PAGE TO A FRIEND

CEP57L1

centrosomal protein 57kDa-like 1

91 Gene Product Result for
Synonyms: C6orf182 bA487F23.2 cep57R
UniProtKB ID: Q8IYX8
Gene ID:
Mouse(103268) centrosomal protein 57-like 1
Rat(294519) centrosomal protein 57-like 1
domestic guinea pig(100713907) centrosomal protein 57kDa-like 1
naked mole-rat(101699131) centrosomal protein 57kDa-like 1
sheep(101115715) centrosomal protein 57kDa-like 1
Zebrafish(445312) centrosomal protein 57-like 1
cow(519522) centrosomal protein 57kDa-like 1
domestic cat(101082061) centrosomal protein 57kDa-like 1
dog(475018) centrosomal protein 57kDa-like 1
chicken(421765) centrosomal protein 57kDa-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2103577 Anti-C6ORF182 antibody produced in rabbit affinity isolated antibody bovine, rat, human, guinea pig, horse, rabbit, canine, mouse
western blot pricing
HPA040378 Anti-CEP57L1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173830 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173830 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173830 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026643 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026643 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026643 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001083535 Rosetta Predictions human pricing
NM_173830 Rosetta Predictions human pricing
NM_001017448 Rosetta Predictions rat pricing
NM_026643 Rosetta Predictions mouse pricing
NM_029132 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083535 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316930 predicted 1888
2 SASI_Hs02_00316931 predicted 838
3 SASI_Hs02_00316932 predicted 1767
4 SASI_Hs02_00316933 predicted 1666
5 SASI_Hs02_00316934 predicted 962
6 SASI_Hs02_00316935 predicted 1183
7 SASI_Hs02_00316936 predicted 914
8 SASI_Hs02_00316937 predicted 928
9 SASI_Hs02_00316938 predicted 1345
10 SASI_Hs02_00316939 predicted 1063
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173830 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00051799 predicted 1501
2 SASI_Hs02_00368692 predicted 448
3 SASI_Hs01_00051800 predicted 1388
4 SASI_Hs02_00368693 predicted 1276
5 SASI_Hs02_00368694 predicted 574
6 SASI_Hs02_00368695 predicted 796
7 SASI_Hs02_00368696 predicted 524
8 SASI_Hs02_00368697 predicted 536
9 SASI_Hs02_00368698 predicted 962
10 SASI_Hs02_00368699 predicted 672
11 SASI_Hs01_00051798 predicted 1552
12 SASI_Hs01_00051801 predicted 1516
13 SASI_Hs01_00051802 predicted 1211
14 SASI_Hs01_00051803 predicted 1402
15 SASI_Hs01_00051804 predicted 1321
16 SASI_Hs01_00051805 predicted 1213
17 SASI_Hs01_00051806 predicted 1338
18 SASI_Hs01_00051807 predicted 1337
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017448 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00048231 predicted 984
2 SASI_Rn01_00048232 predicted 434
3 SASI_Rn02_00202238 predicted 462
4 SASI_Rn01_00048233 predicted 502
5 SASI_Rn01_00048234 predicted 483
6 SASI_Rn01_00048236 predicted 751
7 SASI_Rn01_00048237 predicted 244
8 SASI_Rn02_00202239 predicted 1200
9 SASI_Rn01_00048238 predicted 252
10 SASI_Rn01_00048239 predicted 418
11 SASI_Rn01_00048235 predicted 446
12 SASI_Rn01_00048240 predicted 418
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026643 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00051908 predicted 386
2 SASI_Mm02_00330635 predicted 1111
3 SASI_Mm02_00330636 predicted 1429
4 SASI_Mm01_00051912 predicted 460
5 SASI_Mm02_00330637 predicted 1473
6 SASI_Mm02_00330638 predicted 1523
7 SASI_Mm01_00051913 predicted 1333
8 SASI_Mm02_00330639 predicted 1267
9 SASI_Mm01_00051915 predicted 295
10 SASI_Mm02_00330640 predicted 437
11 SASI_Mm01_00051907 predicted 670
12 SASI_Mm01_00051909 predicted 331
13 SASI_Mm01_00051910 predicted 201
14 SASI_Mm01_00051911 predicted 973
15 SASI_Mm01_00051914 predicted 870
16 SASI_Mm01_00051916 predicted 612
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029132 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00334908 predicted 447
2 SASI_Mm02_00334909 predicted 1269
3 SASI_Mm02_00334910 predicted 1590
4 SASI_Mm02_00334911 predicted 528
5 SASI_Mm02_00334912 predicted 1630
6 SASI_Mm02_00334913 predicted 1685
7 SASI_Mm02_00334914 predicted 1496
8 SASI_Mm02_00334915 predicted 1416
9 SASI_Mm02_00334916 predicted 362
10 SASI_Mm02_00334917 predicted 498
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173830
CEP57L1 MISSION shRNA Bacterial Glycerol Stock
centrosomal protein 57kDa-like 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155287    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173830.3-338s1c1
Sequence:CCGGGCCCAAATAGCCAAGCTCTTACTCGAGTAAGAGCTTGGCTATTTGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173830.3-766s1c1
Sequence:CCGGGCTGAGGACAAGATTAAACATCTCGAGATGTTTAATCTTGTCCTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173830.3-1342s1c1
Sequence:CCGGCATCAAGACAGTGTCTGTAAACTCGAGTTTACAGACACTGTCTTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173830.3-418s1c1
Sequence:CCGGGCTGAAGATAACCTGAACATTCTCGAGAATGTTCAGGTTATCTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151881    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173830.3-317s1c1
Sequence:CCGGCCTCTCCTAAGATACTTCATACTCGAGTATGAAGTATCTTAGGAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152263    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173830.3-323s1c1
Sequence:CCGGCTAAGATACTTCATAGCCCAACTCGAGTTGGGCTATGAAGTATCTTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173830.3-1413s1c1
Sequence:CCGGGCAAGAAGACAGCTACCCTAACTCGAGTTAGGGTAGCTGTCTTCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155059    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173830.3-2159s1c1
Sequence:CCGGGCAGAAGCTTTCCTCTGCTATCTCGAGATAGCAGAGGAAAGCTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173830.4-1253s21c1
Sequence:CCGGATTCAGTCTGTGACGACATAGCTCGAGCTATGTCGTCACAGACTGAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173830.4-956s21c1
Sequence:CCGGGACGACCACCTTGGCAAATTTCTCGAGAAATTTGCCAAGGTGGTCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418640    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173830.4-1928s21c1
Sequence:CCGGTAGTAGGTTTGGAACCTTAAACTCGAGTTTAAGGTTCCAAACCTACTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173830.4-811s21c1
Sequence:CCGGGAACATCAGCGTAAGCTATTTCTCGAGAAATAGCTTACGCTGATGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173830
CEP57L1 MISSION shRNA shRNA Plasmid DNA
centrosomal protein 57kDa-like 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155287    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173830.3-338s1c1
Sequence:CCGGGCCCAAATAGCCAAGCTCTTACTCGAGTAAGAGCTTGGCTATTTGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173830.3-766s1c1
Sequence:CCGGGCTGAGGACAAGATTAAACATCTCGAGATGTTTAATCTTGTCCTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173830.3-1342s1c1
Sequence:CCGGCATCAAGACAGTGTCTGTAAACTCGAGTTTACAGACACTGTCTTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173830.3-418s1c1
Sequence:CCGGGCTGAAGATAACCTGAACATTCTCGAGAATGTTCAGGTTATCTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151881    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173830.3-317s1c1
Sequence:CCGGCCTCTCCTAAGATACTTCATACTCGAGTATGAAGTATCTTAGGAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152263    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173830.3-323s1c1
Sequence:CCGGCTAAGATACTTCATAGCCCAACTCGAGTTGGGCTATGAAGTATCTTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173830.3-1413s1c1
Sequence:CCGGGCAAGAAGACAGCTACCCTAACTCGAGTTAGGGTAGCTGTCTTCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155059    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173830.3-2159s1c1
Sequence:CCGGGCAGAAGCTTTCCTCTGCTATCTCGAGATAGCAGAGGAAAGCTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173830.4-1253s21c1
Sequence:CCGGATTCAGTCTGTGACGACATAGCTCGAGCTATGTCGTCACAGACTGAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173830.4-956s21c1
Sequence:CCGGGACGACCACCTTGGCAAATTTCTCGAGAAATTTGCCAAGGTGGTCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418640    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173830.4-1928s21c1
Sequence:CCGGTAGTAGGTTTGGAACCTTAAACTCGAGTTTAAGGTTCCAAACCTACTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173830.4-811s21c1
Sequence:CCGGGAACATCAGCGTAAGCTATTTCTCGAGAAATAGCTTACGCTGATGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173830
CEP57L1 MISSION shRNA Lentiviral Transduction Particles
centrosomal protein 57kDa-like 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155287    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173830.3-338s1c1
Sequence:CCGGGCCCAAATAGCCAAGCTCTTACTCGAGTAAGAGCTTGGCTATTTGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173830.3-766s1c1
Sequence:CCGGGCTGAGGACAAGATTAAACATCTCGAGATGTTTAATCTTGTCCTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173830.3-1342s1c1
Sequence:CCGGCATCAAGACAGTGTCTGTAAACTCGAGTTTACAGACACTGTCTTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173830.3-418s1c1
Sequence:CCGGGCTGAAGATAACCTGAACATTCTCGAGAATGTTCAGGTTATCTTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151881    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173830.3-317s1c1
Sequence:CCGGCCTCTCCTAAGATACTTCATACTCGAGTATGAAGTATCTTAGGAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152263    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173830.3-323s1c1
Sequence:CCGGCTAAGATACTTCATAGCCCAACTCGAGTTGGGCTATGAAGTATCTTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173830.3-1413s1c1
Sequence:CCGGGCAAGAAGACAGCTACCCTAACTCGAGTTAGGGTAGCTGTCTTCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155059    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173830.3-2159s1c1
Sequence:CCGGGCAGAAGCTTTCCTCTGCTATCTCGAGATAGCAGAGGAAAGCTTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173830.4-1253s21c1
Sequence:CCGGATTCAGTCTGTGACGACATAGCTCGAGCTATGTCGTCACAGACTGAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173830.4-956s21c1
Sequence:CCGGGACGACCACCTTGGCAAATTTCTCGAGAAATTTGCCAAGGTGGTCGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418640    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173830.4-1928s21c1
Sequence:CCGGTAGTAGGTTTGGAACCTTAAACTCGAGTTTAAGGTTCCAAACCTACTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173830.4-811s21c1
Sequence:CCGGGAACATCAGCGTAAGCTATTTCTCGAGAAATAGCTTACGCTGATGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026643
VALIDATED
CEP57L1 MISSION shRNA Bacterial Glycerol Stock
centrosomal protein 57kDa-like 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000184199    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026643.2-1163s1c1
Sequence:CCGGGCATCAAGACAGTGTCCGTAACTCGAGTTACGGACACTGTCTTGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375437    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026643.4-1579s21c1
Sequence:CCGGGTCTGACCTGTGGGTACTATTCTCGAGAATAGTACCCACAGGTCAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026643.4-410s21c1
Sequence:CCGGTCAGCCCAGTCTCGTTGTATTCTCGAGAATACAACGAGACTGGGCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026643.4-1040s21c1
Sequence:CCGGCATCAAGACAGTGTCCGTAAACTCGAGTTTACGGACACTGTCTTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026643.4-1112s21c1
Sequence:CCGGGGCAACCCTAAAGGATCTAAGCTCGAGCTTAGATCCTTTAGGGTTGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026643.4-302s21c1
Sequence:CCGGAGAGAAGCAGCGCAGTATAAGCTCGAGCTTATACTGCGCTGCTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026643.4-620s21c1
Sequence:CCGGACTGCGGAGGACAAGATTAAACTCGAGTTTAATCTTGTCCTCCGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264944    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026643.4-1363s21c1
Sequence:CCGGTATGTTTCTGACTGCTATAAACTCGAGTTTATAGCAGTCAGAAACATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026643.4-359s21c1
Sequence:CCGGGCACACCAGGAGCTGATTAAACTCGAGTTTAATCAGCTCCTGGTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026643
VALIDATED
CEP57L1 MISSION shRNA shRNA Plasmid DNA
centrosomal protein 57kDa-like 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000184199    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026643.2-1163s1c1
Sequence:CCGGGCATCAAGACAGTGTCCGTAACTCGAGTTACGGACACTGTCTTGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375437    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026643.4-1579s21c1
Sequence:CCGGGTCTGACCTGTGGGTACTATTCTCGAGAATAGTACCCACAGGTCAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026643.4-410s21c1
Sequence:CCGGTCAGCCCAGTCTCGTTGTATTCTCGAGAATACAACGAGACTGGGCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026643.4-1040s21c1
Sequence:CCGGCATCAAGACAGTGTCCGTAAACTCGAGTTTACGGACACTGTCTTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026643.4-1112s21c1
Sequence:CCGGGGCAACCCTAAAGGATCTAAGCTCGAGCTTAGATCCTTTAGGGTTGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026643.4-302s21c1
Sequence:CCGGAGAGAAGCAGCGCAGTATAAGCTCGAGCTTATACTGCGCTGCTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026643.4-620s21c1
Sequence:CCGGACTGCGGAGGACAAGATTAAACTCGAGTTTAATCTTGTCCTCCGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264944    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026643.4-1363s21c1
Sequence:CCGGTATGTTTCTGACTGCTATAAACTCGAGTTTATAGCAGTCAGAAACATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000283245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026643.4-359s21c1
Sequence:CCGGGCACACCAGGAGCTGATTAAACTCGAGTTTAATCAGCTCCTGGTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026643
VALIDATED
CEP57L1 MISSION shRNA Lentiviral Transduction Particles
centrosomal protein 57kDa-like 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000184199    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026643.2-1163s1c1
Sequence:CCGGGCATCAAGACAGTGTCCGTAACTCGAGTTACGGACACTGTCTTGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375437    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026643.4-1579s21c1
Sequence:CCGGGTCTGACCTGTGGGTACTATTCTCGAGAATAGTACCCACAGGTCAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026643.4-410s21c1
Sequence:CCGGTCAGCCCAGTCTCGTTGTATTCTCGAGAATACAACGAGACTGGGCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026643.4-1040s21c1
Sequence:CCGGCATCAAGACAGTGTCCGTAAACTCGAGTTTACGGACACTGTCTTGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026643.4-1112s21c1
Sequence:CCGGGGCAACCCTAAAGGATCTAAGCTCGAGCTTAGATCCTTTAGGGTTGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026643.4-302s21c1
Sequence:CCGGAGAGAAGCAGCGCAGTATAAGCTCGAGCTTATACTGCGCTGCTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026643.4-620s21c1
Sequence:CCGGACTGCGGAGGACAAGATTAAACTCGAGTTTAATCTTGTCCTCCGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264944    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026643.4-1363s21c1
Sequence:CCGGTATGTTTCTGACTGCTATAAACTCGAGTTTATAGCAGTCAGAAACATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026643.4-359s21c1
Sequence:CCGGGCACACCAGGAGCTGATTAAACTCGAGTTTAATCAGCTCCTGGTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)