EMAIL THIS PAGE TO A FRIEND

CEP63

centrosomal protein 63kDa

185 Gene Product Result for
Gene ID:
Human(80254) Summary: This gene encodes a protein with six coiled-coil domains. The protein is localized to the centrosome, a non-membraneous organelle that functions as the major microtubule-organizing center in animal cells. Several alternatively spliced transcript variants have been found, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
Mouse(28135) centrosomal protein 63
Rat(300963) centrosomal protein 63
Zebrafish(393574) centrosomal protein 63
chicken(424873) centrosomal protein 63kDa
cow(521932) centrosomal protein 63kDa
Horse(100053151) centrosomal protein 63kDa
domestic cat(101083794) centrosomal protein 63kDa
dog(477075) centrosomal protein 63kDa
sheep(101114919) centrosomal protein 63kDa
naked mole-rat(101723985) centrosomal protein 63kDa
domestic guinea pig(100722754) centrosomal protein 63kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025180 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025180 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025180 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081122 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081122 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081122 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042383 Rosetta Predictions human pricing
NM_001042384 Rosetta Predictions human pricing
NM_001042400 Rosetta Predictions human pricing
NM_025180 Rosetta Predictions human pricing
NM_001037772 Rosetta Predictions rat pricing
NM_001081122 Rosetta Predictions mouse pricing
XM_135158 Rosetta Predictions mouse pricing
XM_897990 Rosetta Predictions mouse pricing
XM_898001 Rosetta Predictions mouse pricing
XM_898012 Rosetta Predictions mouse pricing
XM_898053 Rosetta Predictions mouse pricing
XM_898062 Rosetta Predictions mouse pricing
XM_898077 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042383 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00309368 predicted 612
2 SASI_Hs02_00309369 predicted 641
3 SASI_Hs02_00309370 predicted 941
4 SASI_Hs02_00309371 predicted 749
5 SASI_Hs02_00309372 predicted 1007
6 SASI_Hs02_00309373 predicted 999
7 SASI_Hs02_00309374 predicted 812
8 SASI_Hs02_00309375 predicted 528
9 SASI_Hs02_00309376 predicted 740
10 SASI_Hs02_00309377 predicted 737
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042384 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00309378 predicted 612
2 SASI_Hs02_00309379 predicted 638
3 SASI_Hs02_00309380 predicted 946
4 SASI_Hs02_00309381 predicted 751
5 SASI_Hs02_00309382 predicted 1002
6 SASI_Hs02_00309383 predicted 994
7 SASI_Hs02_00309384 predicted 815
8 SASI_Hs02_00309385 predicted 527
9 SASI_Hs02_00309386 predicted 738
10 SASI_Hs02_00309387 predicted 739
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042400 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00309528 predicted 439
2 SASI_Hs02_00309529 predicted 469
3 SASI_Hs02_00309530 predicted 773
4 SASI_Hs02_00309531 predicted 579
5 SASI_Hs02_00309532 predicted 833
6 SASI_Hs02_00309533 predicted 823
7 SASI_Hs02_00309534 predicted 642
8 SASI_Hs02_00309535 predicted 356
9 SASI_Hs02_00309536 predicted 564
10 SASI_Hs02_00309537 predicted 571
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025180 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00200757 predicted 710
2 SASI_Hs02_00357931 predicted 749
3 SASI_Hs02_00357932 predicted 1045
4 SASI_Hs02_00357933 predicted 850
5 SASI_Hs02_00357934 predicted 1107
6 SASI_Hs01_00200765 predicted 1104
7 SASI_Hs02_00357935 predicted 914
8 SASI_Hs01_00200766 predicted 627
9 SASI_Hs02_00357936 predicted 844
10 SASI_Hs02_00357937 predicted 847
11 SASI_Hs01_00200758 predicted 1698
12 SASI_Hs01_00200759 predicted 2528
13 SASI_Hs01_00200760 predicted 2357
14 SASI_Hs01_00200761 predicted 1710
15 SASI_Hs01_00200762 predicted 1479
16 SASI_Hs01_00200763 predicted 2133
17 SASI_Hs01_00200764 predicted 1449
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037772 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00068021 predicted 621
2 SASI_Rn01_00068022 predicted 1754
3 SASI_Rn01_00068023 predicted 880
4 SASI_Rn01_00068024 predicted 787
5 SASI_Rn01_00068025 predicted 1187
6 SASI_Rn01_00068026 predicted 540
7 SASI_Rn01_00068027 predicted 451
8 SASI_Rn01_00068028 predicted 1396
9 SASI_Rn01_00068029 predicted 436
10 SASI_Rn01_00068030 predicted 349
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081122 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00295401 predicted 1443
2 SASI_Mm02_00295402 predicted 721
3 SASI_Mm02_00295403 predicted 549
4 SASI_Mm02_00295404 predicted 981
5 SASI_Mm02_00295405 predicted 2244
6 SASI_Mm02_00295406 predicted 639
7 SASI_Mm02_00295407 predicted 1585
8 SASI_Mm02_00295408 predicted 1080
9 SASI_Mm02_00295409 predicted 905
10 SASI_Mm02_00295410 predicted 675
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_135158 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00275200 predicted 1364
2 SASI_Mm01_00275201 predicted 1452
3 SASI_Mm01_00275202 predicted 1443
4 SASI_Mm01_00275203 predicted 1412
5 SASI_Mm01_00275204 predicted 1368
6 SASI_Mm01_00275205 predicted 1358
7 SASI_Mm01_00275206 predicted 1385
8 SASI_Mm01_00275207 predicted 1288
9 SASI_Mm01_00275208 predicted 1287
10 SASI_Mm01_00275209 predicted 1464
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897990 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00241299 predicted 1336
2 SASI_Mm01_00241300 predicted 1420
3 SASI_Mm01_00241301 predicted 1423
4 SASI_Mm01_00241302 predicted 1389
5 SASI_Mm01_00241303 predicted 1343
6 SASI_Mm01_00241304 predicted 1337
7 SASI_Mm01_00241305 predicted 1364
8 SASI_Mm01_00241306 predicted 1257
9 SASI_Mm01_00241307 predicted 1269
10 SASI_Mm01_00241308 predicted 1439
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898001 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00276306 predicted 2373
2 SASI_Mm01_00276307 predicted 2452
3 SASI_Mm01_00276308 predicted 2456
4 SASI_Mm01_00276309 predicted 2850
5 SASI_Mm01_00276310 predicted 2589
6 SASI_Mm01_00276311 predicted 2375
7 SASI_Mm01_00276312 predicted 2558
8 SASI_Mm01_00276313 predicted 2578
9 SASI_Mm01_00276314 predicted 2396
10 SASI_Mm01_00276315 predicted 2295
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898012 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00227159 predicted 453
2 SASI_Mm01_00227160 predicted 546
3 SASI_Mm01_00227161 predicted 540
4 SASI_Mm01_00227162 predicted 883
5 SASI_Mm01_00227163 predicted 938
6 SASI_Mm01_00227164 predicted 687
7 SASI_Mm01_00227165 predicted 465
8 SASI_Mm01_00227166 predicted 647
9 SASI_Mm01_00227167 predicted 667
10 SASI_Mm01_00227168 predicted 483
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898053 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00208653 predicted 1336
2 SASI_Mm01_00208654 predicted 1420
3 SASI_Mm01_00208655 predicted 1421
4 SASI_Mm01_00208656 predicted 1812
5 SASI_Mm01_00208657 predicted 1569
6 SASI_Mm01_00208658 predicted 1350
7 SASI_Mm01_00208659 predicted 1531
8 SASI_Mm01_00208660 predicted 1553
9 SASI_Mm01_00208661 predicted 1359
10 SASI_Mm01_00208662 predicted 1257
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898062 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00265402 predicted 1353
2 SASI_Mm01_00265403 predicted 1449
3 SASI_Mm01_00265404 predicted 1447
4 SASI_Mm01_00265405 predicted 1840
5 SASI_Mm01_00265406 predicted 1582
6 SASI_Mm01_00265407 predicted 1372
7 SASI_Mm01_00265408 predicted 1546
8 SASI_Mm01_00265409 predicted 1573
9 SASI_Mm01_00265410 predicted 1378
10 SASI_Mm01_00265411 predicted 1279
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898077 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00202134 predicted 2365
2 SASI_Mm01_00202135 predicted 2454
3 SASI_Mm01_00202136 predicted 2451
4 SASI_Mm01_00202137 predicted 2414
5 SASI_Mm01_00202138 predicted 2373
6 SASI_Mm01_00202139 predicted 2373
7 SASI_Mm01_00202140 predicted 2389
8 SASI_Mm01_00202141 predicted 2295
9 SASI_Mm01_00202142 predicted 2299
10 SASI_Mm01_00202143 predicted 2469
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025180
VALIDATED
CEP63 MISSION shRNA Bacterial Glycerol Stock
centrosomal protein 63kDa
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000330448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025180.3-1005s21c1
Sequence:CCGGGCTCAGCTTGTCAATCGGAAACTCGAGTTTCCGATTGACAAGCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025180.3-2198s21c1
Sequence:CCGGACAAGCGTCGGATAGTATAAACTCGAGTTTATACTATCCGACGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025180.3-1269s21c1
Sequence:CCGGGCAGCTCTTCAGTCTCAAGAACTCGAGTTCTTGAGACTGAAGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025180.3-2285s21c1
Sequence:CCGGGACTTCCTACTCTCTATGTAACTCGAGTTACATAGAGAGTAGGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025180.2-983s1c1
Sequence:CCGGGCTCAGCTTGTCAATCGGAAACTCGAGTTTCCGATTGACAAGCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025180.2-2263s1c1
Sequence:CCGGGACTTCCTACTCTCTATGTAACTCGAGTTACATAGAGAGTAGGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134421    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025180.2-2585s1c1
Sequence:CCGGGAGTTACTGTCATCTGAAGTACTCGAGTACTTCAGATGACAGTAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_025180.2-2305s1c1
Sequence:CCGGGCTAGATACAAATGAAGCCAACTCGAGTTGGCTTCATTTGTATCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025180.2-1247s1c1
Sequence:CCGGGCAGCTCTTCAGTCTCAAGAACTCGAGTTCTTGAGACTGAAGAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134915    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025180.2-2598s1c1
Sequence:CCGGCTGAAGTAGCAGCTCTTTAAACTCGAGTTTAAAGAGCTGCTACTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025180.2-2005s1c1
Sequence:CCGGGCTGGAGATTTCTACTCAGATCTCGAGATCTGAGTAGAAATCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025180
VALIDATED
CEP63 MISSION shRNA shRNA Plasmid DNA
centrosomal protein 63kDa
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000330448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025180.3-1005s21c1
Sequence:CCGGGCTCAGCTTGTCAATCGGAAACTCGAGTTTCCGATTGACAAGCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025180.3-2198s21c1
Sequence:CCGGACAAGCGTCGGATAGTATAAACTCGAGTTTATACTATCCGACGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025180.3-1269s21c1
Sequence:CCGGGCAGCTCTTCAGTCTCAAGAACTCGAGTTCTTGAGACTGAAGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025180.3-2285s21c1
Sequence:CCGGGACTTCCTACTCTCTATGTAACTCGAGTTACATAGAGAGTAGGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025180.2-983s1c1
Sequence:CCGGGCTCAGCTTGTCAATCGGAAACTCGAGTTTCCGATTGACAAGCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025180.2-2263s1c1
Sequence:CCGGGACTTCCTACTCTCTATGTAACTCGAGTTACATAGAGAGTAGGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134421    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025180.2-2585s1c1
Sequence:CCGGGAGTTACTGTCATCTGAAGTACTCGAGTACTTCAGATGACAGTAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_025180.2-2305s1c1
Sequence:CCGGGCTAGATACAAATGAAGCCAACTCGAGTTGGCTTCATTTGTATCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025180.2-1247s1c1
Sequence:CCGGGCAGCTCTTCAGTCTCAAGAACTCGAGTTCTTGAGACTGAAGAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134915    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025180.2-2598s1c1
Sequence:CCGGCTGAAGTAGCAGCTCTTTAAACTCGAGTTTAAAGAGCTGCTACTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025180.2-2005s1c1
Sequence:CCGGGCTGGAGATTTCTACTCAGATCTCGAGATCTGAGTAGAAATCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025180
VALIDATED
CEP63 MISSION shRNA Lentiviral Transduction Particles
centrosomal protein 63kDa
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000330448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025180.3-1005s21c1
Sequence:CCGGGCTCAGCTTGTCAATCGGAAACTCGAGTTTCCGATTGACAAGCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025180.3-2198s21c1
Sequence:CCGGACAAGCGTCGGATAGTATAAACTCGAGTTTATACTATCCGACGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025180.3-1269s21c1
Sequence:CCGGGCAGCTCTTCAGTCTCAAGAACTCGAGTTCTTGAGACTGAAGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025180.3-2285s21c1
Sequence:CCGGGACTTCCTACTCTCTATGTAACTCGAGTTACATAGAGAGTAGGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025180.2-983s1c1
Sequence:CCGGGCTCAGCTTGTCAATCGGAAACTCGAGTTTCCGATTGACAAGCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025180.2-2263s1c1
Sequence:CCGGGACTTCCTACTCTCTATGTAACTCGAGTTACATAGAGAGTAGGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134421    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025180.2-2585s1c1
Sequence:CCGGGAGTTACTGTCATCTGAAGTACTCGAGTACTTCAGATGACAGTAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_025180.2-2305s1c1
Sequence:CCGGGCTAGATACAAATGAAGCCAACTCGAGTTGGCTTCATTTGTATCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025180.2-1247s1c1
Sequence:CCGGGCAGCTCTTCAGTCTCAAGAACTCGAGTTCTTGAGACTGAAGAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134915    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025180.2-2598s1c1
Sequence:CCGGCTGAAGTAGCAGCTCTTTAAACTCGAGTTTAAAGAGCTGCTACTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025180.2-2005s1c1
Sequence:CCGGGCTGGAGATTTCTACTCAGATCTCGAGATCTGAGTAGAAATCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081122
VALIDATED
CEP63 MISSION shRNA Bacterial Glycerol Stock
centrosomal protein 63kDa
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081122.1-1581s21c1
Sequence:CCGGCACCAGCGAGATATCACTATTCTCGAGAATAGTGATATCTCGCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081122.1-848s21c1
Sequence:CCGGGGCTGAACAGTCGGAGATAATCTCGAGATTATCTCCGACTGTTCAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081122.1-1997s21c1
Sequence:CCGGGCACAGACATGACGGAATAAACTCGAGTTTATTCCGTCATGTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081122.1-400s21c1
Sequence:CCGGTCATGAAACAGATCGATATAACTCGAGTTATATCGATCTGTTTCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256651    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081122.1-2434s21c1
Sequence:CCGGCAGACGGAAGACTGGATTATACTCGAGTATAATCCAGTCTTCCGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081122
VALIDATED
CEP63 MISSION shRNA shRNA Plasmid DNA
centrosomal protein 63kDa
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081122.1-1581s21c1
Sequence:CCGGCACCAGCGAGATATCACTATTCTCGAGAATAGTGATATCTCGCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081122.1-848s21c1
Sequence:CCGGGGCTGAACAGTCGGAGATAATCTCGAGATTATCTCCGACTGTTCAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081122.1-1997s21c1
Sequence:CCGGGCACAGACATGACGGAATAAACTCGAGTTTATTCCGTCATGTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081122.1-400s21c1
Sequence:CCGGTCATGAAACAGATCGATATAACTCGAGTTATATCGATCTGTTTCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256651    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081122.1-2434s21c1
Sequence:CCGGCAGACGGAAGACTGGATTATACTCGAGTATAATCCAGTCTTCCGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081122
VALIDATED
CEP63 MISSION shRNA Lentiviral Transduction Particles
centrosomal protein 63kDa
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081122.1-1581s21c1
Sequence:CCGGCACCAGCGAGATATCACTATTCTCGAGAATAGTGATATCTCGCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081122.1-848s21c1
Sequence:CCGGGGCTGAACAGTCGGAGATAATCTCGAGATTATCTCCGACTGTTCAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081122.1-1997s21c1
Sequence:CCGGGCACAGACATGACGGAATAAACTCGAGTTTATTCCGTCATGTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081122.1-400s21c1
Sequence:CCGGTCATGAAACAGATCGATATAACTCGAGTTATATCGATCTGTTTCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256651    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081122.1-2434s21c1
Sequence:CCGGCAGACGGAAGACTGGATTATACTCGAGTATAATCCAGTCTTCCGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks