EMAIL THIS PAGE TO A FRIEND

CEP68

centrosomal protein 68kDa

59 Gene Product Result for
Synonyms: KIAA0582
Gene ID:
Mouse(216543) centrosomal protein 68
Rat(289822) centrosomal protein 68
domestic guinea pig(100727574) centrosomal protein 68kDa
naked mole-rat(101712973) centrosomal protein 68kDa
sheep(101117660) centrosomal protein 68kDa
Domestic Rabbit(100348382) centrosomal protein 68kDa
Zebrafish(541505) centrosomal protein 68
cow(540684) centrosomal protein 68kDa
Horse(100063103) centrosomal protein 68kDa
domestic cat(101091437) centrosomal protein 68kDa
dog(481393) centrosomal protein 68kDa
chicken(421274) centrosomal protein 68kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015147 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015147 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015147 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172260 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172260 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172260 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015147 Rosetta Predictions human pricing
XM_001059836 Rosetta Predictions rat pricing
XM_214106 Rosetta Predictions rat pricing
NM_172260 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015147 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00347094 predicted 1249
2 SASI_Hs02_00347095 predicted 2200
3 SASI_Hs02_00347096 predicted 1104
4 SASI_Hs02_00347097 predicted 2130
5 SASI_Hs02_00347098 predicted 248
6 SASI_Hs01_00094351 predicted 2181
7 SASI_Hs01_00094353 predicted 1518
8 SASI_Hs01_00094355 predicted 661
9 SASI_Hs01_00094356 predicted 1630
10 SASI_Hs02_00347099 predicted 2119
11 SASI_Hs01_00094348 predicted 1734
12 SASI_Hs01_00094349 predicted 1368
13 SASI_Hs01_00094350 predicted 465
14 SASI_Hs01_00094352 predicted 1616
15 SASI_Hs01_00094354 predicted 1708
16 SASI_Hs01_00094357 predicted 504
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059836 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00294507 predicted 2054
2 SASI_Rn02_00294508 predicted 2065
3 SASI_Rn02_00294509 predicted 1995
4 SASI_Rn02_00294510 predicted 486
5 SASI_Rn02_00294511 predicted 471
6 SASI_Rn02_00294512 predicted 2077
7 SASI_Rn02_00294513 predicted 978
8 SASI_Rn02_00294514 predicted 1112
9 SASI_Rn02_00294515 predicted 1133
10 SASI_Rn02_00294516 predicted 872
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_214106 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00375141 predicted 1241
2 SASI_Rn02_00375142 predicted 390
3 SASI_Rn02_00375143 predicted 474
4 SASI_Rn02_00375144 predicted 753
5 SASI_Rn02_00375145 predicted 809
6 SASI_Rn02_00375146 predicted 979
7 SASI_Rn02_00375147 predicted 1113
8 SASI_Rn02_00375148 predicted 242
9 SASI_Rn02_00375149 predicted 409
10 SASI_Rn02_00375150 predicted 1119
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172260 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00156306 predicted 2057
2 SASI_Mm01_00156307 predicted 2060
3 SASI_Mm01_00156308 predicted 2002
4 SASI_Mm01_00156309 predicted 2256
5 SASI_Mm01_00156310 predicted 2072
6 SASI_Mm01_00156312 predicted 879
7 SASI_Mm01_00156313 predicted 999
8 SASI_Mm01_00156314 predicted 1796
9 SASI_Mm01_00156315 predicted 2157
10 SASI_Mm02_00343726 predicted 1707
11 SASI_Mm01_00156311 predicted 2443
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015147
VALIDATED
CEP68 MISSION shRNA Bacterial Glycerol Stock
centrosomal protein 68kDa
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130472    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015147.1-1769s1c1
Sequence:CCGGGATTCTTCTTCAGTGCCTGTTCTCGAGAACAGGCACTGAAGAAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_015147.1-1607s1c1
Sequence:CCGGGCTGATCTGCTGGCTGTATAACTCGAGTTATACAGCCAGCAGATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015147.1-1539s1c1
Sequence:CCGGGAAAGTGATGACGAGTATCTTCTCGAGAAGATACTCGTCATCACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015147.1-1387s1c1
Sequence:CCGGCTATAGGCAAGCACCTTGATACTCGAGTATCAAGGTGCTTGCCTATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015147.1-1527s1c1
Sequence:CCGGGAAGAGGAAGTGGAAAGTGATCTCGAGATCACTTTCCACTTCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_015147.1-552s1c1
Sequence:CCGGGATGCTGATACCGAAGATGATCTCGAGATCATCTTCGGTATCAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_015147.1-1144s1c1
Sequence:CCGGGCACCCTCAAATCACCTACTACTCGAGTAGTAGGTGATTTGAGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_015147.1-1016s1c1
Sequence:CCGGGCTTGACTATACTTACCCACTCTCGAGAGTGGGTAAGTATAGTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015147.1-1694s1c1
Sequence:CCGGGCAGCTTTACCGGCAATTTAACTCGAGTTAAATTGCCGGTAAAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015147.2-1250s21c1
Sequence:CCGGACCCTCAAATCACCTACTAATCTCGAGATTAGTAGGTGATTTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015147.2-656s21c1
Sequence:CCGGGATGCTGATACCGAAGATGATCTCGAGATCATCTTCGGTATCAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015147.2-1701s21c1
Sequence:CCGGTTTCGTATCTAGGATCCATTTCTCGAGAAATGGATCCTAGATACGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015147.2-1120s21c1
Sequence:CCGGGCTTGACTATACTTACCCACTCTCGAGAGTGGGTAAGTATAGTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015147
VALIDATED
CEP68 MISSION shRNA shRNA Plasmid DNA
centrosomal protein 68kDa
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130472    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015147.1-1769s1c1
Sequence:CCGGGATTCTTCTTCAGTGCCTGTTCTCGAGAACAGGCACTGAAGAAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_015147.1-1607s1c1
Sequence:CCGGGCTGATCTGCTGGCTGTATAACTCGAGTTATACAGCCAGCAGATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015147.1-1539s1c1
Sequence:CCGGGAAAGTGATGACGAGTATCTTCTCGAGAAGATACTCGTCATCACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015147.1-1387s1c1
Sequence:CCGGCTATAGGCAAGCACCTTGATACTCGAGTATCAAGGTGCTTGCCTATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015147.1-1527s1c1
Sequence:CCGGGAAGAGGAAGTGGAAAGTGATCTCGAGATCACTTTCCACTTCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_015147.1-552s1c1
Sequence:CCGGGATGCTGATACCGAAGATGATCTCGAGATCATCTTCGGTATCAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_015147.1-1144s1c1
Sequence:CCGGGCACCCTCAAATCACCTACTACTCGAGTAGTAGGTGATTTGAGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_015147.1-1016s1c1
Sequence:CCGGGCTTGACTATACTTACCCACTCTCGAGAGTGGGTAAGTATAGTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015147.1-1694s1c1
Sequence:CCGGGCAGCTTTACCGGCAATTTAACTCGAGTTAAATTGCCGGTAAAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015147.2-1250s21c1
Sequence:CCGGACCCTCAAATCACCTACTAATCTCGAGATTAGTAGGTGATTTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015147.2-656s21c1
Sequence:CCGGGATGCTGATACCGAAGATGATCTCGAGATCATCTTCGGTATCAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015147.2-1701s21c1
Sequence:CCGGTTTCGTATCTAGGATCCATTTCTCGAGAAATGGATCCTAGATACGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015147.2-1120s21c1
Sequence:CCGGGCTTGACTATACTTACCCACTCTCGAGAGTGGGTAAGTATAGTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015147
VALIDATED
CEP68 MISSION shRNA Lentiviral Transduction Particles
centrosomal protein 68kDa
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130472    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015147.1-1769s1c1
Sequence:CCGGGATTCTTCTTCAGTGCCTGTTCTCGAGAACAGGCACTGAAGAAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_015147.1-1607s1c1
Sequence:CCGGGCTGATCTGCTGGCTGTATAACTCGAGTTATACAGCCAGCAGATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015147.1-1539s1c1
Sequence:CCGGGAAAGTGATGACGAGTATCTTCTCGAGAAGATACTCGTCATCACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015147.1-1387s1c1
Sequence:CCGGCTATAGGCAAGCACCTTGATACTCGAGTATCAAGGTGCTTGCCTATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015147.1-1527s1c1
Sequence:CCGGGAAGAGGAAGTGGAAAGTGATCTCGAGATCACTTTCCACTTCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_015147.1-552s1c1
Sequence:CCGGGATGCTGATACCGAAGATGATCTCGAGATCATCTTCGGTATCAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_015147.1-1144s1c1
Sequence:CCGGGCACCCTCAAATCACCTACTACTCGAGTAGTAGGTGATTTGAGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_015147.1-1016s1c1
Sequence:CCGGGCTTGACTATACTTACCCACTCTCGAGAGTGGGTAAGTATAGTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015147.1-1694s1c1
Sequence:CCGGGCAGCTTTACCGGCAATTTAACTCGAGTTAAATTGCCGGTAAAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015147.2-1250s21c1
Sequence:CCGGACCCTCAAATCACCTACTAATCTCGAGATTAGTAGGTGATTTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015147.2-656s21c1
Sequence:CCGGGATGCTGATACCGAAGATGATCTCGAGATCATCTTCGGTATCAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015147.2-1701s21c1
Sequence:CCGGTTTCGTATCTAGGATCCATTTCTCGAGAAATGGATCCTAGATACGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015147.2-1120s21c1
Sequence:CCGGGCTTGACTATACTTACCCACTCTCGAGAGTGGGTAAGTATAGTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172260
VALIDATED
CEP68 MISSION shRNA Bacterial Glycerol Stock
centrosomal protein 68kDa
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000193906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172260.1-509s1c1
Sequence:CCGGCAGCTCTTCAAGTCTTTGGAACTCGAGTTCCAAAGACTTGAAGAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172260.1-1240s1c1
Sequence:CCGGCCCTTGGGAATATTCCAGAAACTCGAGTTTCTGGAATATTCCCAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176034    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172260.1-3121s1c1
Sequence:CCGGGCATCAGTTACAGCTTTCCAACTCGAGTTGGAAAGCTGTAACTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172260.1-2249s1c1
Sequence:CCGGCAGATCATCTTTATGACTCTACTCGAGTAGAGTCATAAAGATGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172260.3-379s21c1
Sequence:CCGGCCAGTAGCAGATAGGTCTAAGCTCGAGCTTAGACCTATCTGCTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172260.3-512s21c1
Sequence:CCGGCAGCTCTTCAAGTCTTTGGAACTCGAGTTCCAAAGACTTGAAGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339811    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172260.3-3124s21c1
Sequence:CCGGGCATCAGTTACAGCTTTCCAACTCGAGTTGGAAAGCTGTAACTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172260.3-1243s21c1
Sequence:CCGGCCCTTGGGAATATTCCAGAAACTCGAGTTTCTGGAATATTCCCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172260
VALIDATED
CEP68 MISSION shRNA shRNA Plasmid DNA
centrosomal protein 68kDa
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000193906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172260.1-509s1c1
Sequence:CCGGCAGCTCTTCAAGTCTTTGGAACTCGAGTTCCAAAGACTTGAAGAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172260.1-1240s1c1
Sequence:CCGGCCCTTGGGAATATTCCAGAAACTCGAGTTTCTGGAATATTCCCAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176034    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172260.1-3121s1c1
Sequence:CCGGGCATCAGTTACAGCTTTCCAACTCGAGTTGGAAAGCTGTAACTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172260.1-2249s1c1
Sequence:CCGGCAGATCATCTTTATGACTCTACTCGAGTAGAGTCATAAAGATGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172260.3-379s21c1
Sequence:CCGGCCAGTAGCAGATAGGTCTAAGCTCGAGCTTAGACCTATCTGCTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172260.3-512s21c1
Sequence:CCGGCAGCTCTTCAAGTCTTTGGAACTCGAGTTCCAAAGACTTGAAGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339811    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172260.3-3124s21c1
Sequence:CCGGGCATCAGTTACAGCTTTCCAACTCGAGTTGGAAAGCTGTAACTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172260.3-1243s21c1
Sequence:CCGGCCCTTGGGAATATTCCAGAAACTCGAGTTTCTGGAATATTCCCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172260
VALIDATED
CEP68 MISSION shRNA Lentiviral Transduction Particles
centrosomal protein 68kDa
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000193906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172260.1-509s1c1
Sequence:CCGGCAGCTCTTCAAGTCTTTGGAACTCGAGTTCCAAAGACTTGAAGAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172260.1-1240s1c1
Sequence:CCGGCCCTTGGGAATATTCCAGAAACTCGAGTTTCTGGAATATTCCCAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176034    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172260.1-3121s1c1
Sequence:CCGGGCATCAGTTACAGCTTTCCAACTCGAGTTGGAAAGCTGTAACTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172260.1-2249s1c1
Sequence:CCGGCAGATCATCTTTATGACTCTACTCGAGTAGAGTCATAAAGATGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172260.3-379s21c1
Sequence:CCGGCCAGTAGCAGATAGGTCTAAGCTCGAGCTTAGACCTATCTGCTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172260.3-512s21c1
Sequence:CCGGCAGCTCTTCAAGTCTTTGGAACTCGAGTTCCAAAGACTTGAAGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339811    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172260.3-3124s21c1
Sequence:CCGGGCATCAGTTACAGCTTTCCAACTCGAGTTGGAAAGCTGTAACTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172260.3-1243s21c1
Sequence:CCGGCCCTTGGGAATATTCCAGAAACTCGAGTTTCTGGAATATTCCCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks