EMAIL THIS PAGE TO A FRIEND

CEP70

centrosomal protein 70kDa

120 Gene Product Result for
Synonyms: BITE
Gene ID:
Mouse(68121) centrosomal protein 70
Rat(367153) centrosomal protein 70
Zebrafish(100136857) centrosomal protein 70
dog(477084) centrosomal protein 70kDa
cow(100301027) centrosomal protein 70kDa
Horse(100064729) centrosomal protein 70kDa
domestic cat(101101077) centrosomal protein 70kDa
chicken(429044) centrosomal protein 70kDa
sheep(101111770) centrosomal protein 70kDa
naked mole-rat(101711930) centrosomal protein 70kDa
domestic guinea pig(100727429) centrosomal protein 70kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024491 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024491 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024491 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023873 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023873 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023873 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024491 Rosetta Predictions human pricing
NM_001017470 Rosetta Predictions rat pricing
NM_023873 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024491 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00184323 predicted 462
2 SASI_Hs01_00184325 predicted 1133
3 SASI_Hs02_00356756 predicted 273
4 SASI_Hs01_00184326 predicted 1217
5 SASI_Hs01_00184327 predicted 1254
6 SASI_Hs02_00356757 predicted 1723
7 SASI_Hs01_00184328 predicted 436
8 SASI_Hs01_00184329 predicted 1734
9 SASI_Hs01_00184330 predicted 429
10 SASI_Hs01_00184331 predicted 748
11 SASI_Hs01_00184322 predicted 1914
12 SASI_Hs01_00184324 predicted 1658
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017470 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00075620 predicted 1420
2 SASI_Rn02_00202276 predicted 412
3 SASI_Rn01_00075621 predicted 283
4 SASI_Rn01_00075622 predicted 1643
5 SASI_Rn01_00075623 predicted 358
6 SASI_Rn01_00075624 predicted 452
7 SASI_Rn01_00075627 predicted 568
8 SASI_Rn01_00075628 predicted 430
9 SASI_Rn01_00075629 predicted 340
10 SASI_Rn02_00202277 predicted 1448
11 SASI_Rn01_00075625 predicted 341
12 SASI_Rn01_00075626 predicted 1497
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023873 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00327419 predicted 292
2 SASI_Mm01_00171339 predicted 1793
3 SASI_Mm01_00171340 predicted 1699
4 SASI_Mm02_00327420 predicted 1261
5 SASI_Mm01_00171341 predicted 1305
6 SASI_Mm02_00327421 predicted 506
7 SASI_Mm01_00171342 predicted 1592
8 SASI_Mm01_00171343 predicted 1697
9 SASI_Mm02_00327422 predicted 829
10 SASI_Mm01_00171345 predicted 570
11 SASI_Mm01_00171344 predicted 1153
12 SASI_Mm01_00171346 predicted 2253
13 SASI_Mm01_00171347 predicted 855
14 SASI_Mm01_00171348 predicted 1229
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024491
VALIDATED
CEP70 MISSION shRNA Bacterial Glycerol Stock
centrosomal protein 70kDa
Human
19 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434676    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024491.2-2177s21c1
Sequence:CCGGTAGTTGCAAGGGTAAGGTAATCTCGAGATTACCTTACCCTTGCAACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024491.2-1248s21c1
Sequence:CCGGGGTGCTGTGTAGCATCAATTCCTCGAGGAATTGATGCTACACAGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024491.2-878s21c1
Sequence:CCGGTTCATACACAAAGGCAATATACTCGAGTATATTGCCTTTGTGTATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024491.2-303s21c1
Sequence:CCGGATTGATGATGCATGGCTTAAACTCGAGTTTAAGCCATGCATCATCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024491.2-1226s21c1
Sequence:CCGCTAATTGACCAGAGATACTTTCCTCGAGGAAAGTATCTCTGGTCAATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024491.2-1139s21c1
Sequence:CCGGTCAAATTACAGGAGCTTATTACTCGAGTAATAAGCTCCTGTAATTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024491.1-1585s1c1
Sequence:CCGGGCCTTCTTTAAATGGAGTCTACTCGAGTAGACTCCATTTAAAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144592    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024491.1-391s1c1
Sequence:CCGGGAACATGATACAGGAGCTTATCTCGAGATAAGCTCCTGTATCATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145182    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024491.1-1417s1c1
Sequence:CCGGGCTTAATTTGAAGAAGCAGGACTCGAGTCCTGCTTCTTCAAATTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142573    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024491.1-1546s1c1
Sequence:CCGGGCAAGCTATTGTTCCTCACTTCTCGAGAAGTGAGGAACAATAGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024491.1-1760s1c1
Sequence:CCGGGAGCAGGTTATGCAGGTATTACTCGAGTAATACCTGCATAACCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142143    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024491.1-1748s1c1
Sequence:CCGGGAAGATGTGAATGAGCAGGTTCTCGAGAACCTGCTCATTCACATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024491.1-642s1c1
Sequence:CCGGGAACGGAGCAAGAAGAAACTACTCGAGTAGTTTCTTCTTGCTCCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141989    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024491.1-1517s1c1
Sequence:CCGGGACAGCAATATGCCACACTTTCTCGAGAAAGTGTGGCATATTGCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_024491.1-465s1c1
Sequence:CCGGCCAATCAAGAACAACGAGCTACTCGAGTAGCTCGTTGTTCTTGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141646    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024491.1-476s1c1
Sequence:CCGGCAACGAGCTAATGACTTGGAACTCGAGTTCCAAGTCATTAGCTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024491.1-1708s1c1
Sequence:CCGGGCTAGTAAGCACTGTTGGAAACTCGAGTTTCCAACAGTGCTTACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_024491.1-401s1c1
Sequence:CCGGCAGGAGCTTATAGAAACTAATCTCGAGATTAGTTTCTATAAGCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024491.1-1346s1c1
Sequence:CCGGGCAGATCAACTGACATCCTTACTCGAGTAAGGATGTCAGTTGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024491
VALIDATED
CEP70 MISSION shRNA shRNA Plasmid DNA
centrosomal protein 70kDa
Human
19 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434676    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024491.2-2177s21c1
Sequence:CCGGTAGTTGCAAGGGTAAGGTAATCTCGAGATTACCTTACCCTTGCAACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024491.2-1248s21c1
Sequence:CCGGGGTGCTGTGTAGCATCAATTCCTCGAGGAATTGATGCTACACAGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024491.2-878s21c1
Sequence:CCGGTTCATACACAAAGGCAATATACTCGAGTATATTGCCTTTGTGTATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024491.2-303s21c1
Sequence:CCGGATTGATGATGCATGGCTTAAACTCGAGTTTAAGCCATGCATCATCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024491.2-1226s21c1
Sequence:CCGCTAATTGACCAGAGATACTTTCCTCGAGGAAAGTATCTCTGGTCAATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024491.2-1139s21c1
Sequence:CCGGTCAAATTACAGGAGCTTATTACTCGAGTAATAAGCTCCTGTAATTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024491.1-1585s1c1
Sequence:CCGGGCCTTCTTTAAATGGAGTCTACTCGAGTAGACTCCATTTAAAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144592    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024491.1-391s1c1
Sequence:CCGGGAACATGATACAGGAGCTTATCTCGAGATAAGCTCCTGTATCATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145182    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024491.1-1417s1c1
Sequence:CCGGGCTTAATTTGAAGAAGCAGGACTCGAGTCCTGCTTCTTCAAATTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142573    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024491.1-1546s1c1
Sequence:CCGGGCAAGCTATTGTTCCTCACTTCTCGAGAAGTGAGGAACAATAGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024491.1-1760s1c1
Sequence:CCGGGAGCAGGTTATGCAGGTATTACTCGAGTAATACCTGCATAACCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142143    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024491.1-1748s1c1
Sequence:CCGGGAAGATGTGAATGAGCAGGTTCTCGAGAACCTGCTCATTCACATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024491.1-642s1c1
Sequence:CCGGGAACGGAGCAAGAAGAAACTACTCGAGTAGTTTCTTCTTGCTCCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141989    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024491.1-1517s1c1
Sequence:CCGGGACAGCAATATGCCACACTTTCTCGAGAAAGTGTGGCATATTGCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_024491.1-465s1c1
Sequence:CCGGCCAATCAAGAACAACGAGCTACTCGAGTAGCTCGTTGTTCTTGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141646    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024491.1-476s1c1
Sequence:CCGGCAACGAGCTAATGACTTGGAACTCGAGTTCCAAGTCATTAGCTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024491.1-1708s1c1
Sequence:CCGGGCTAGTAAGCACTGTTGGAAACTCGAGTTTCCAACAGTGCTTACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_024491.1-401s1c1
Sequence:CCGGCAGGAGCTTATAGAAACTAATCTCGAGATTAGTTTCTATAAGCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024491.1-1346s1c1
Sequence:CCGGGCAGATCAACTGACATCCTTACTCGAGTAAGGATGTCAGTTGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024491
VALIDATED
CEP70 MISSION shRNA Lentiviral Transduction Particles
centrosomal protein 70kDa
Human
19 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434676    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024491.2-2177s21c1
Sequence:CCGGTAGTTGCAAGGGTAAGGTAATCTCGAGATTACCTTACCCTTGCAACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024491.2-1248s21c1
Sequence:CCGGGGTGCTGTGTAGCATCAATTCCTCGAGGAATTGATGCTACACAGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024491.2-878s21c1
Sequence:CCGGTTCATACACAAAGGCAATATACTCGAGTATATTGCCTTTGTGTATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024491.2-303s21c1
Sequence:CCGGATTGATGATGCATGGCTTAAACTCGAGTTTAAGCCATGCATCATCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024491.2-1226s21c1
Sequence:CCGCTAATTGACCAGAGATACTTTCCTCGAGGAAAGTATCTCTGGTCAATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024491.2-1139s21c1
Sequence:CCGGTCAAATTACAGGAGCTTATTACTCGAGTAATAAGCTCCTGTAATTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024491.1-1585s1c1
Sequence:CCGGGCCTTCTTTAAATGGAGTCTACTCGAGTAGACTCCATTTAAAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144592    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024491.1-391s1c1
Sequence:CCGGGAACATGATACAGGAGCTTATCTCGAGATAAGCTCCTGTATCATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145182    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024491.1-1417s1c1
Sequence:CCGGGCTTAATTTGAAGAAGCAGGACTCGAGTCCTGCTTCTTCAAATTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142573    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024491.1-1546s1c1
Sequence:CCGGGCAAGCTATTGTTCCTCACTTCTCGAGAAGTGAGGAACAATAGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024491.1-1760s1c1
Sequence:CCGGGAGCAGGTTATGCAGGTATTACTCGAGTAATACCTGCATAACCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142143    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024491.1-1748s1c1
Sequence:CCGGGAAGATGTGAATGAGCAGGTTCTCGAGAACCTGCTCATTCACATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024491.1-642s1c1
Sequence:CCGGGAACGGAGCAAGAAGAAACTACTCGAGTAGTTTCTTCTTGCTCCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141989    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024491.1-1517s1c1
Sequence:CCGGGACAGCAATATGCCACACTTTCTCGAGAAAGTGTGGCATATTGCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_024491.1-465s1c1
Sequence:CCGGCCAATCAAGAACAACGAGCTACTCGAGTAGCTCGTTGTTCTTGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141646    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024491.1-476s1c1
Sequence:CCGGCAACGAGCTAATGACTTGGAACTCGAGTTCCAAGTCATTAGCTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024491.1-1708s1c1
Sequence:CCGGGCTAGTAAGCACTGTTGGAAACTCGAGTTTCCAACAGTGCTTACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_024491.1-401s1c1
Sequence:CCGGCAGGAGCTTATAGAAACTAATCTCGAGATTAGTTTCTATAAGCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024491.1-1346s1c1
Sequence:CCGGGCAGATCAACTGACATCCTTACTCGAGTAAGGATGTCAGTTGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023873
VALIDATED
CEP70 MISSION shRNA Bacterial Glycerol Stock
centrosomal protein 70kDa
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000248411    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023873.3-2254s21c1
Sequence:CCGGAGTACAGAAAGTCGCAGTTAACTCGAGTTAACTGCGACTTTCTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023873.3-1199s21c1
Sequence:CCGGTCATTGAGCAGAGCTACTTTCCTCGAGGAAAGTAGCTCTGCTCAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023873.3-1431s21c1
Sequence:CCGGGGTGCCTTGGCATAGCTTAAACTCGAGTTTAAGCTATGCCAAGGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023873.3-1775s21c1
Sequence:CCGGATGTGAGTGAGCAGGTTAAACCTCGAGGTTTAACCTGCTCACTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023873.3-1256s21c1
Sequence:CCGGCACGAGCTCCAGTGATTATTTCTCGAGAAATAATCACTGGAGCTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175284    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023873.2-1387s1c1
Sequence:CCGGCCTATAATAGAAATGTGGGTACTCGAGTACCCACATTTCTATTATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174420    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023873.2-2301s1c1
Sequence:CCGGCGCAGTTAACTTCAAGGTTTACTCGAGTAAACCTTGAAGTTAACTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173639    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023873.2-214s1c1
Sequence:CCGGCTGTCTCCAGTAGCCTCTAAACTCGAGTTTAGAGGCTACTGGAGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023873
VALIDATED
CEP70 MISSION shRNA shRNA Plasmid DNA
centrosomal protein 70kDa
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000248411    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023873.3-2254s21c1
Sequence:CCGGAGTACAGAAAGTCGCAGTTAACTCGAGTTAACTGCGACTTTCTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023873.3-1199s21c1
Sequence:CCGGTCATTGAGCAGAGCTACTTTCCTCGAGGAAAGTAGCTCTGCTCAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023873.3-1431s21c1
Sequence:CCGGGGTGCCTTGGCATAGCTTAAACTCGAGTTTAAGCTATGCCAAGGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023873.3-1775s21c1
Sequence:CCGGATGTGAGTGAGCAGGTTAAACCTCGAGGTTTAACCTGCTCACTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023873.3-1256s21c1
Sequence:CCGGCACGAGCTCCAGTGATTATTTCTCGAGAAATAATCACTGGAGCTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175284    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023873.2-1387s1c1
Sequence:CCGGCCTATAATAGAAATGTGGGTACTCGAGTACCCACATTTCTATTATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174420    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023873.2-2301s1c1
Sequence:CCGGCGCAGTTAACTTCAAGGTTTACTCGAGTAAACCTTGAAGTTAACTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173639    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023873.2-214s1c1
Sequence:CCGGCTGTCTCCAGTAGCCTCTAAACTCGAGTTTAGAGGCTACTGGAGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023873
VALIDATED
CEP70 MISSION shRNA Lentiviral Transduction Particles
centrosomal protein 70kDa
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000248411    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023873.3-2254s21c1
Sequence:CCGGAGTACAGAAAGTCGCAGTTAACTCGAGTTAACTGCGACTTTCTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023873.3-1199s21c1
Sequence:CCGGTCATTGAGCAGAGCTACTTTCCTCGAGGAAAGTAGCTCTGCTCAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023873.3-1431s21c1
Sequence:CCGGGGTGCCTTGGCATAGCTTAAACTCGAGTTTAAGCTATGCCAAGGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023873.3-1775s21c1
Sequence:CCGGATGTGAGTGAGCAGGTTAAACCTCGAGGTTTAACCTGCTCACTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023873.3-1256s21c1
Sequence:CCGGCACGAGCTCCAGTGATTATTTCTCGAGAAATAATCACTGGAGCTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175284    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023873.2-1387s1c1
Sequence:CCGGCCTATAATAGAAATGTGGGTACTCGAGTACCCACATTTCTATTATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174420    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023873.2-2301s1c1
Sequence:CCGGCGCAGTTAACTTCAAGGTTTACTCGAGTAAACCTTGAAGTTAACTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173639    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023873.2-214s1c1
Sequence:CCGGCTGTCTCCAGTAGCCTCTAAACTCGAGTTTAGAGGCTACTGGAGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks